ID: 962881512

View in Genome Browser
Species Human (GRCh38)
Location 3:139581523-139581545
Sequence TTGTTGTAGCATGTATCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962881512_962881513 29 Left 962881512 3:139581523-139581545 CCTATGGATACATGCTACAACAA 0: 1
1: 1
2: 0
3: 14
4: 141
Right 962881513 3:139581575-139581597 GAGAAAGCCAAACCAAAAAAAGG 0: 2
1: 0
2: 7
3: 65
4: 696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962881512 Original CRISPR TTGTTGTAGCATGTATCCAT AGG (reversed) Intronic
902076659 1:13792385-13792407 TTGTCGTAGCATTTAATCATTGG + Intronic
902822626 1:18952536-18952558 ATGTTGTAGCATGTATTTGTAGG - Intronic
903156982 1:21452377-21452399 TTTTGGTAGCATGTATCCTAAGG - Intronic
914677261 1:149914654-149914676 TTGTTGAAGCCTGTAAACATGGG - Intronic
914862038 1:151394731-151394753 TTTTTGTAGCATTTATCCTTTGG - Intergenic
915730074 1:158047131-158047153 TCTTTGTAGCTTGTAGCCATTGG - Intronic
917003583 1:170387126-170387148 TTGTTGGAGTATATATCCAAAGG - Intergenic
917654705 1:177114538-177114560 TTGTTTTGCCATGTTTCCATTGG - Intronic
918457906 1:184743776-184743798 TTGGTTTATCATGTATACATGGG - Intronic
919557597 1:199078796-199078818 GTGTTGTAACATGTATTAATAGG - Intergenic
919675805 1:200381954-200381976 TTGTTAAAGCAAGTATGCATGGG - Intergenic
920632467 1:207665944-207665966 GTGTTGGACCATGTATACATGGG + Intronic
921425189 1:214993241-214993263 TTGGTGTTGATTGTATCCATTGG + Intergenic
1065621119 10:27582882-27582904 TTATTGTTGCATGTATCAATAGG + Intergenic
1065663673 10:28034904-28034926 TTGTTGTTGTCTGCATCCATTGG + Intergenic
1066378388 10:34880223-34880245 TAGTTTTAGCATTTATACATAGG - Intergenic
1067152936 10:43751470-43751492 TTGTTTTAGGATGTATCACTTGG + Intergenic
1075423023 10:122318299-122318321 ATGTTGTTGCATGTATCAGTAGG + Intronic
1077759199 11:5072528-5072550 TTTATTTAGCATGTATACATTGG - Intergenic
1079044591 11:17089907-17089929 TTGTTGTAGCTTGTATACAGTGG - Exonic
1079570823 11:21941814-21941836 TTATTGTAACATATATCCATAGG - Intergenic
1079940199 11:26671130-26671152 TTGTTGTAGCTTTTGTCCTTAGG + Exonic
1080556653 11:33423184-33423206 TTGTTGTAACATGTTTCAATAGG + Intergenic
1080893394 11:36428495-36428517 TTGTTGGAGCATGAATGGATGGG + Intronic
1085996666 11:81924999-81925021 TTGTGATAGCATGTCTCCTTAGG + Intergenic
1086650881 11:89288442-89288464 TTGTAGTAAAAAGTATCCATTGG - Intronic
1089630791 11:119782996-119783018 CTGCTGGAGCAGGTATCCATTGG + Intergenic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1095101496 12:38189792-38189814 TTGCTGCAACATGTATGCATAGG - Intergenic
1095159731 12:38903050-38903072 TTGTTGGATCTTGTAACCATAGG - Intronic
1095882677 12:47154954-47154976 TTGTTTTAGCAGGAATCCATGGG + Intronic
1098546236 12:71714694-71714716 TTGTTGAAGAAAGTATCCTTTGG - Intergenic
1099633383 12:85179054-85179076 TTGTTATTGCCTGTAACCATAGG - Intronic
1101479211 12:105081187-105081209 TTGTTGTCCCTTGTATTCATAGG - Intronic
1102713458 12:114949147-114949169 TTTTTCTTGCATGTAACCATTGG + Intergenic
1104203332 12:126613586-126613608 GTGTTATACCATGCATCCATGGG - Intergenic
1105235780 13:18552005-18552027 TTGTTTTAGCAAGAATACATAGG - Intergenic
1108424476 13:50285199-50285221 TTCTTATAACATTTATCCATTGG + Intronic
1110346530 13:74454255-74454277 TTTTTATAGCTTGTATCTATTGG - Intergenic
1111675450 13:91382049-91382071 TACTTATAGCATGTGTCCATTGG + Intergenic
1111943761 13:94641768-94641790 TAGTTTCAGGATGTATCCATAGG - Intergenic
1116278227 14:42865406-42865428 TTGTTTTAGCATGTATGTGTGGG + Intergenic
1120208707 14:81613217-81613239 TTTATTTAGCATGTATACATGGG + Intergenic
1125170829 15:36764753-36764775 TTGCAGTAAGATGTATCCATGGG + Intronic
1126524521 15:49636160-49636182 TTGTTGTAGCATGTATCAATAGG + Intronic
1130780723 15:87036998-87037020 TTGTTATAGGCTGTAGCCATTGG - Intergenic
1132369899 15:101288622-101288644 TGGTTGTAGCTGGTAACCATAGG - Intronic
1132413124 15:101600513-101600535 TTGTTGTTGTCTGTAGCCATTGG + Intergenic
1137334985 16:47539512-47539534 TTGTTGAAGAATGTATCTATTGG + Intronic
1138844373 16:60547562-60547584 TTGTTGTAGCATAAATTAATGGG - Intergenic
1153399213 18:4665121-4665143 ATGTTGAAGCATGTATCAGTAGG - Intergenic
1154513761 18:15137993-15138015 TTGTTTTAGCAAGAATACATAGG + Intergenic
1154997532 18:21654974-21654996 TTGTTTTAGCATATTTTCATTGG - Intronic
1158270001 18:55702336-55702358 TTGTTATAACATGTATGAATAGG + Intergenic
1158472338 18:57748335-57748357 TTGTGGCAGCATGTCTCCAAGGG - Intronic
1159809987 18:73006583-73006605 TTGTTGTAGGATGTTTTCAAAGG + Intergenic
1165605170 19:37096339-37096361 TTGCTGTTTCTTGTATCCATGGG + Intronic
924973071 2:148824-148846 CTGCTGTAGCATGGATACATTGG - Intergenic
925354033 2:3224639-3224661 TTGTTGGAGCAGTTATCCCTGGG - Intronic
926353617 2:12020043-12020065 TTGTTTTTCCATGTATCCTTGGG + Intergenic
926736888 2:16080431-16080453 TTGTTGTACCATTTGTCCACTGG + Intergenic
926788316 2:16542766-16542788 ATGTTGTTGCATGTATCAATAGG - Intergenic
929124187 2:38508504-38508526 TTGCTGTTGCATGTGTCAATAGG - Intergenic
929360350 2:41081522-41081544 TTTTTACAGTATGTATCCATTGG + Intergenic
930386203 2:50698331-50698353 TTGTGATAGCATATATCCTTTGG - Intronic
930926560 2:56824865-56824887 TTGCTGTGGGATGTGTCCATAGG - Intergenic
932180515 2:69642791-69642813 TAGTTGTTGCATGTATGAATGGG - Intronic
934126992 2:88904546-88904568 CTGTTTTAGCATGTATCAGTAGG + Intergenic
935271457 2:101437691-101437713 TTTTTGTAAAATGTAACCATCGG - Intronic
938398739 2:130969947-130969969 ATGTTGTTGCATTTATCCTTAGG + Intronic
938514003 2:131982604-131982626 TTGTTTTAGCAAGAATACATAGG + Intergenic
940344815 2:152618271-152618293 TTGTTGTAACATTTTCCCATCGG - Intronic
943092350 2:183390174-183390196 TTGTTGTCACATGTGTGCATGGG - Intergenic
1173205251 20:40987872-40987894 CTCTTGTAGCATATGTCCATTGG - Intergenic
1176779781 21:13180291-13180313 TTGTTTTAGCAAGAATACATAGG - Intergenic
1177641092 21:23845589-23845611 TCCTTGTAGCATTTCTCCATGGG + Intergenic
949531462 3:4959927-4959949 TTCTTGTAGCATGGGTCCAATGG - Intergenic
950827393 3:15838937-15838959 ATGTTGTAACATGTATTAATTGG - Intronic
952486324 3:33815206-33815228 TTGTTATGGCTTGTAACCATAGG + Intronic
954703215 3:52463268-52463290 ATATTGTAGCATGAATCCATTGG + Intronic
957478054 3:80752702-80752724 TTATTTTAGTCTGTATCCATAGG + Intergenic
959511924 3:107223343-107223365 TTGTTGAACCATTCATCCATTGG - Intergenic
961833273 3:129635913-129635935 CTGTAGTAGCACCTATCCATAGG - Intergenic
962881512 3:139581523-139581545 TTGTTGTAGCATGTATCCATAGG - Intronic
965307753 3:167088312-167088334 TTGTTTTAGCATCTAAACATGGG + Intergenic
966043321 3:175518889-175518911 TTGTTTTAATATGTATACATAGG + Intronic
967384362 3:188896744-188896766 TTGTTCTTGCATGTGTCAATTGG - Intergenic
967495585 3:190141559-190141581 TTATTGTTTCATGTATGCATAGG - Intergenic
967681442 3:192368742-192368764 TTGTTGTAGCATGAAAGCAGAGG - Intronic
970552230 4:17193771-17193793 TTGATGTAGCATATATGGATAGG - Intergenic
973544726 4:51969322-51969344 TTTTTGTAGCAATTGTCCATAGG + Intergenic
976424956 4:84892174-84892196 ATGTTTTGGAATGTATCCATGGG + Intronic
978171158 4:105671913-105671935 TTGCTATAGCATGTTTCCAAGGG + Intronic
978502211 4:109421632-109421654 TTGTTCTAGCATTTCACCATTGG - Intergenic
978567534 4:110100035-110100057 TTTATGTGGCATTTATCCATGGG - Intronic
979312845 4:119224317-119224339 TTAATGTAGCATTTATACATCGG - Intronic
981764228 4:148229616-148229638 CTGTGGTAACATGTATCTATGGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
983068302 4:163237424-163237446 TTATTGAAGCATGTATGCCTTGG + Intergenic
986553143 5:8981309-8981331 TAGTTGCAGCATGAATCCACGGG + Intergenic
986903692 5:12468004-12468026 TTGCTGGAGCATGTGTGCATGGG + Intergenic
989141905 5:38209858-38209880 TTGTGGCAGCATCTGTCCATAGG - Intergenic
992846206 5:80751157-80751179 TTGTTAGAGCATGTCTCAATAGG + Intronic
994872512 5:105370822-105370844 TTGTTTAAGCATTCATCCATTGG - Intergenic
995896311 5:117015288-117015310 TTGTTTTTGCATATATACATTGG + Intergenic
996529014 5:124508104-124508126 TTTCTGTAGCATCTGTCCATTGG + Intergenic
1000841748 5:166228438-166228460 TTGTTATAGCATGTATTTACTGG + Intergenic
1002260357 5:177989675-177989697 TGGTTGTAACATGTATGAATAGG + Intergenic
1003167705 6:3695790-3695812 TAATAGTAGCATGTATTCATGGG - Intergenic
1003322991 6:5069014-5069036 TTGTTGTAGCATGTCTGAAGAGG - Intergenic
1004386024 6:15173424-15173446 ATGTTGTAGCATGTGTCAAAAGG - Intergenic
1005406254 6:25490920-25490942 TTGTTTTTGCAAGTATCCAGTGG + Intronic
1005493206 6:26366077-26366099 ATGTAGTAGCTTGTAACCATGGG - Intronic
1007448084 6:41922061-41922083 TGCTCCTAGCATGTATCCATTGG + Intronic
1007714063 6:43844198-43844220 ATGTTGTGGCATGTATCAGTAGG + Intergenic
1010709506 6:79156533-79156555 TTGTTATAACATGTATGAATAGG - Intergenic
1012312955 6:97750895-97750917 TTGATGTAGAATGTAGCAATTGG - Intergenic
1014647610 6:123993867-123993889 TAGTTGTAGCATGGTTCTATTGG - Intronic
1017067375 6:150541600-150541622 TAGTTGTAAAATGTATCCATCGG + Intergenic
1017688152 6:156934215-156934237 TTATTATAGCATGTCTCAATTGG - Intronic
1019040061 6:169096304-169096326 GTGTTGTACCATGTATCAAGAGG + Intergenic
1020566182 7:9798684-9798706 ATGTTGTCGCATGTATCAATAGG - Intergenic
1020595095 7:10196979-10197001 TTGTTTTTACATGTTTCCATTGG + Intergenic
1023435656 7:40137994-40138016 TTGTTTTGGCATATATTCATGGG + Intronic
1024039711 7:45542674-45542696 ATGTGCTTGCATGTATCCATCGG + Intergenic
1029481390 7:100815358-100815380 ATGTTGTAGTATATATCCGTGGG - Intronic
1030358890 7:108574329-108574351 TTGTTTTAATATGTATCCATAGG - Exonic
1031652982 7:124314714-124314736 TTGTTGTATTATATATACATAGG - Intergenic
1032657744 7:133950280-133950302 TTGAAGTGGCATGTATCCCTCGG - Intronic
1036068835 8:5417466-5417488 TGCTTATAGTATGTATCCATGGG + Intergenic
1042208513 8:66353128-66353150 TGATTGTAAAATGTATCCATGGG + Intergenic
1042971994 8:74419354-74419376 AAGTTGTTGCATGTATCAATAGG - Intronic
1043267081 8:78279788-78279810 TGGTTGTGGCTTGTATCCAAGGG - Intergenic
1044602862 8:94023304-94023326 ATGTTGTTGCATGTATCAGTAGG - Intergenic
1045462811 8:102441113-102441135 TTCTTTTAGCATGGATCAATAGG + Intergenic
1046799356 8:118408193-118408215 CTTTTGTAGCATGTATACAAGGG - Intronic
1046991047 8:120454044-120454066 TTGATACAGAATGTATCCATGGG + Intronic
1047517181 8:125565164-125565186 GTGCTCTAGGATGTATCCATAGG - Intergenic
1050716140 9:8528617-8528639 TTGTTGTTGCTTGTGTCCACAGG + Exonic
1054805439 9:69392477-69392499 TTGTTATTACATGTATCCTTCGG + Intergenic
1058188465 9:101884343-101884365 TTGTTATAGCAGGTCTCCACTGG - Intergenic
1061645822 9:132000676-132000698 ATATTGTTGCATGTATCAATAGG - Intronic
1061689337 9:132312920-132312942 TCCTTGTAGCATGTATTAATAGG - Intronic
1187619948 X:21041143-21041165 TTGTTGTTCCATATTTCCATAGG + Intergenic
1188216725 X:27488090-27488112 TTGTTGTAACTTATTTCCATTGG + Intergenic
1189871576 X:45389016-45389038 TTTTTGTAGCAAGTATAAATGGG + Intergenic
1190631078 X:52387051-52387073 ATGTTGTGGCATTTTTCCATGGG - Intergenic
1190632674 X:52402922-52402944 TTATTGTGGCATTTTTCCATGGG + Intergenic
1191815264 X:65237317-65237339 TTTTTGTAGCATTTATGAATGGG + Intergenic
1193309609 X:79990249-79990271 TTTTTGTAGCAATTATTCATGGG - Intergenic
1194334896 X:92633388-92633410 ATGTTGTAGCATGTATGATTAGG + Intergenic
1194711364 X:97240716-97240738 TCGTGGTAGCATGTATACAGTGG + Intronic
1195255603 X:103086435-103086457 TTGTTGTAGTGTTTATCCTTAGG - Intronic
1196216512 X:113058515-113058537 ATGTTGTTGCATGTATCAATAGG + Intergenic
1196984874 X:121257550-121257572 TTGTTGAAGGATTGATCCATGGG - Intergenic
1198611434 X:138405525-138405547 TTTTTGTAGCACCTATCCATTGG + Intergenic
1200643374 Y:5750439-5750461 ATGTTGTAGCATGTATGATTAGG + Intergenic