ID: 962882468

View in Genome Browser
Species Human (GRCh38)
Location 3:139591315-139591337
Sequence CAGCGCGATTCCGTGGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2942
Summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962882468_962882471 13 Left 962882468 3:139591315-139591337 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 962882471 3:139591351-139591373 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588
962882468_962882475 30 Left 962882468 3:139591315-139591337 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 962882475 3:139591368-139591390 GCAAGGCGGCAACGAGGCTCGGG 0: 1
1: 330
2: 1210
3: 1957
4: 1748
962882468_962882472 16 Left 962882468 3:139591315-139591337 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 962882472 3:139591354-139591376 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
962882468_962882473 24 Left 962882468 3:139591315-139591337 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 962882473 3:139591362-139591384 CAAACTGCAAGGCGGCAACGAGG 0: 317
1: 1166
2: 1768
3: 1553
4: 836
962882468_962882474 29 Left 962882468 3:139591315-139591337 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 962882474 3:139591367-139591389 TGCAAGGCGGCAACGAGGCTCGG 0: 317
1: 1173
2: 1908
3: 1654
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962882468 Original CRISPR CAGCGCGATTCCGTGGGCGT AGG (reversed) Intronic
Too many off-targets to display for this crispr