ID: 962882471

View in Genome Browser
Species Human (GRCh38)
Location 3:139591351-139591373
Sequence CAGTCTGAGATCAAACTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6913
Summary {0: 3663, 1: 1439, 2: 732, 3: 491, 4: 588}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962882466_962882471 28 Left 962882466 3:139591300-139591322 CCTGGCTCAGAGGGTCCTACGCC 0: 522
1: 1421
2: 1460
3: 1026
4: 831
Right 962882471 3:139591351-139591373 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588
962882468_962882471 13 Left 962882468 3:139591315-139591337 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 962882471 3:139591351-139591373 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588
962882469_962882471 7 Left 962882469 3:139591321-139591343 CCCACGGAATCGCGCTGATTGCT 0: 18
1: 502
2: 1053
3: 1038
4: 855
Right 962882471 3:139591351-139591373 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588
962882470_962882471 6 Left 962882470 3:139591322-139591344 CCACGGAATCGCGCTGATTGCTA 0: 18
1: 494
2: 1064
3: 1054
4: 865
Right 962882471 3:139591351-139591373 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962882471 Original CRISPR CAGTCTGAGATCAAACTGCA AGG Intronic
Too many off-targets to display for this crispr