ID: 962882472

View in Genome Browser
Species Human (GRCh38)
Location 3:139591354-139591376
Sequence TCTGAGATCAAACTGCAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4985
Summary {0: 2869, 1: 1007, 2: 456, 3: 293, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962882468_962882472 16 Left 962882468 3:139591315-139591337 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 962882472 3:139591354-139591376 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
962882469_962882472 10 Left 962882469 3:139591321-139591343 CCCACGGAATCGCGCTGATTGCT 0: 18
1: 502
2: 1053
3: 1038
4: 855
Right 962882472 3:139591354-139591376 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
962882470_962882472 9 Left 962882470 3:139591322-139591344 CCACGGAATCGCGCTGATTGCTA 0: 18
1: 494
2: 1064
3: 1054
4: 865
Right 962882472 3:139591354-139591376 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962882472 Original CRISPR TCTGAGATCAAACTGCAAGG CGG Intronic
Too many off-targets to display for this crispr