ID: 962882473

View in Genome Browser
Species Human (GRCh38)
Location 3:139591362-139591384
Sequence CAAACTGCAAGGCGGCAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5640
Summary {0: 317, 1: 1166, 2: 1768, 3: 1553, 4: 836}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962882470_962882473 17 Left 962882470 3:139591322-139591344 CCACGGAATCGCGCTGATTGCTA 0: 18
1: 494
2: 1064
3: 1054
4: 865
Right 962882473 3:139591362-139591384 CAAACTGCAAGGCGGCAACGAGG 0: 317
1: 1166
2: 1768
3: 1553
4: 836
962882469_962882473 18 Left 962882469 3:139591321-139591343 CCCACGGAATCGCGCTGATTGCT 0: 18
1: 502
2: 1053
3: 1038
4: 855
Right 962882473 3:139591362-139591384 CAAACTGCAAGGCGGCAACGAGG 0: 317
1: 1166
2: 1768
3: 1553
4: 836
962882468_962882473 24 Left 962882468 3:139591315-139591337 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 962882473 3:139591362-139591384 CAAACTGCAAGGCGGCAACGAGG 0: 317
1: 1166
2: 1768
3: 1553
4: 836

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962882473 Original CRISPR CAAACTGCAAGGCGGCAACG AGG Intronic
Too many off-targets to display for this crispr