ID: 962882474

View in Genome Browser
Species Human (GRCh38)
Location 3:139591367-139591389
Sequence TGCAAGGCGGCAACGAGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5754
Summary {0: 317, 1: 1173, 2: 1908, 3: 1654, 4: 702}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962882469_962882474 23 Left 962882469 3:139591321-139591343 CCCACGGAATCGCGCTGATTGCT 0: 18
1: 502
2: 1053
3: 1038
4: 855
Right 962882474 3:139591367-139591389 TGCAAGGCGGCAACGAGGCTCGG 0: 317
1: 1173
2: 1908
3: 1654
4: 702
962882470_962882474 22 Left 962882470 3:139591322-139591344 CCACGGAATCGCGCTGATTGCTA 0: 18
1: 494
2: 1064
3: 1054
4: 865
Right 962882474 3:139591367-139591389 TGCAAGGCGGCAACGAGGCTCGG 0: 317
1: 1173
2: 1908
3: 1654
4: 702
962882468_962882474 29 Left 962882468 3:139591315-139591337 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 962882474 3:139591367-139591389 TGCAAGGCGGCAACGAGGCTCGG 0: 317
1: 1173
2: 1908
3: 1654
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962882474 Original CRISPR TGCAAGGCGGCAACGAGGCT CGG Intronic
Too many off-targets to display for this crispr