ID: 962882475

View in Genome Browser
Species Human (GRCh38)
Location 3:139591368-139591390
Sequence GCAAGGCGGCAACGAGGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5246
Summary {0: 1, 1: 330, 2: 1210, 3: 1957, 4: 1748}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962882468_962882475 30 Left 962882468 3:139591315-139591337 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 962882475 3:139591368-139591390 GCAAGGCGGCAACGAGGCTCGGG 0: 1
1: 330
2: 1210
3: 1957
4: 1748
962882469_962882475 24 Left 962882469 3:139591321-139591343 CCCACGGAATCGCGCTGATTGCT 0: 18
1: 502
2: 1053
3: 1038
4: 855
Right 962882475 3:139591368-139591390 GCAAGGCGGCAACGAGGCTCGGG 0: 1
1: 330
2: 1210
3: 1957
4: 1748
962882470_962882475 23 Left 962882470 3:139591322-139591344 CCACGGAATCGCGCTGATTGCTA 0: 18
1: 494
2: 1064
3: 1054
4: 865
Right 962882475 3:139591368-139591390 GCAAGGCGGCAACGAGGCTCGGG 0: 1
1: 330
2: 1210
3: 1957
4: 1748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962882475 Original CRISPR GCAAGGCGGCAACGAGGCTC GGG Intronic
Too many off-targets to display for this crispr