ID: 962883148

View in Genome Browser
Species Human (GRCh38)
Location 3:139598259-139598281
Sequence ACACAGACTTCACCTCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 3, 2: 20, 3: 60, 4: 335}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962883148_962883153 -6 Left 962883148 3:139598259-139598281 CCATTGAGAGGTGAAGTCTGTGT 0: 1
1: 3
2: 20
3: 60
4: 335
Right 962883153 3:139598276-139598298 CTGTGTTCCTCCTAGGGGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 190
962883148_962883155 -4 Left 962883148 3:139598259-139598281 CCATTGAGAGGTGAAGTCTGTGT 0: 1
1: 3
2: 20
3: 60
4: 335
Right 962883155 3:139598278-139598300 GTGTTCCTCCTAGGGGGCTGGGG 0: 1
1: 0
2: 2
3: 19
4: 169
962883148_962883159 25 Left 962883148 3:139598259-139598281 CCATTGAGAGGTGAAGTCTGTGT 0: 1
1: 3
2: 20
3: 60
4: 335
Right 962883159 3:139598307-139598329 TTTGTGACTGCTTTACTCAATGG 0: 1
1: 0
2: 1
3: 19
4: 224
962883148_962883154 -5 Left 962883148 3:139598259-139598281 CCATTGAGAGGTGAAGTCTGTGT 0: 1
1: 3
2: 20
3: 60
4: 335
Right 962883154 3:139598277-139598299 TGTGTTCCTCCTAGGGGGCTGGG 0: 1
1: 0
2: 5
3: 14
4: 146
962883148_962883156 0 Left 962883148 3:139598259-139598281 CCATTGAGAGGTGAAGTCTGTGT 0: 1
1: 3
2: 20
3: 60
4: 335
Right 962883156 3:139598282-139598304 TCCTCCTAGGGGGCTGGGGTAGG 0: 1
1: 0
2: 3
3: 42
4: 431
962883148_962883152 -10 Left 962883148 3:139598259-139598281 CCATTGAGAGGTGAAGTCTGTGT 0: 1
1: 3
2: 20
3: 60
4: 335
Right 962883152 3:139598272-139598294 AAGTCTGTGTTCCTCCTAGGGGG 0: 1
1: 0
2: 0
3: 19
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962883148 Original CRISPR ACACAGACTTCACCTCTCAA TGG (reversed) Intronic
900944104 1:5820003-5820025 AAACAGACTCCACCTCTTGAGGG + Intergenic
901505712 1:9684166-9684188 ACACAGAGGCCATCTCTCAATGG + Intronic
903028555 1:20446632-20446654 AAACAGACTCCACCTCTTGAGGG + Intergenic
904299544 1:29545357-29545379 GCATAGACTCCACCTCTCTATGG + Intergenic
904491234 1:30860670-30860692 ACACAGTTTTAACCTTTCAAAGG + Intergenic
905468298 1:38172589-38172611 ACATAGACTCCACCTCTCGGTGG + Intergenic
908938446 1:69403625-69403647 ACACAGACTCCAGCTCTTGATGG - Intergenic
909335460 1:74467219-74467241 ACAGAGATTTAACCTCTCCATGG - Intronic
909780161 1:79535002-79535024 TCTCAGACTTCATTTCTCAATGG + Intergenic
910294754 1:85633320-85633342 ACAGAAACATCAGCTCTCAAGGG + Intergenic
913429570 1:118776158-118776180 AGACAGACTCCACCTCTTCAGGG - Intergenic
915148911 1:153813376-153813398 GCACAGATTTCACCCCTCACTGG - Exonic
915477506 1:156161497-156161519 ACGCAGTCTTCACCTCCCAGTGG + Exonic
915698160 1:157765747-157765769 GCACAGACTTCACCTCTAAATGG - Intronic
915946813 1:160158769-160158791 AGATAGACTCCACCTCTTAATGG + Intronic
916099985 1:161386348-161386370 ATACAGACTCCACCTCTTAATGG - Intergenic
916369593 1:164075528-164075550 ACACAGAAATCAGCTCTTAAAGG - Intergenic
917409641 1:174745409-174745431 ACAGAGACCTTAACTCTCAATGG + Intronic
917500218 1:175578872-175578894 AGACAGACTTCACCTCACCAGGG - Intronic
919206968 1:194431065-194431087 CCACAGGCTTCACTTCTCAATGG + Intergenic
919477069 1:198042165-198042187 ACATGGACTTCACCTCTTGATGG - Intergenic
920831540 1:209470148-209470170 ACCCACACTGCACCCCTCAAGGG + Intergenic
921314342 1:213876188-213876210 ACACAGCCTTCACCTCAGGAAGG - Intergenic
921410354 1:214829803-214829825 CCAAAGGCTTCACCTCCCAAAGG + Intergenic
922596540 1:226817942-226817964 AGACAGACTCCACCTCTTGATGG + Intergenic
1063359644 10:5441138-5441160 CCACAGACTTCTCCTCTCAACGG + Intronic
1065509716 10:26466354-26466376 ACACAGACCCCACTTCTTAATGG + Intronic
1065966196 10:30772563-30772585 ACATAGACTCCACTTGTCAATGG + Intergenic
1066124364 10:32325330-32325352 ACACATACCTCACCCCACAATGG + Intronic
1066230093 10:33423852-33423874 ATACAGTCTCCACCTCTCAAAGG - Intergenic
1068461603 10:57336878-57336900 CCAGTGGCTTCACCTCTCAATGG + Intergenic
1069585133 10:69594872-69594894 ACACTGACTTCTCATCTGAATGG - Intergenic
1069836538 10:71312782-71312804 ACATAGACTTCAACTCTTGATGG - Intergenic
1071270466 10:84002069-84002091 ACATAGACCCTACCTCTCAATGG - Intergenic
1071275881 10:84054628-84054650 ACATACACTTCACCTCTTGATGG - Intergenic
1072220929 10:93326976-93326998 ACACAGACCCCACCTCTTCATGG - Intronic
1072251888 10:93588268-93588290 ACGCAGATTTCTCCTCTGAAGGG + Exonic
1073467446 10:103702481-103702503 AAACAGTCTTCATCTTTCAAGGG - Intronic
1073775995 10:106786630-106786652 AAATAGACTTCACCTCTCAAGGG + Intronic
1077160640 11:1110975-1110997 ACACACACATCACCTCCCCAGGG - Intergenic
1077436873 11:2545315-2545337 ACACAAACTCCACCTCTAAAAGG - Intronic
1077471874 11:2767417-2767439 AAACAGACTCCATCTCTTAATGG + Intronic
1077955334 11:7013261-7013283 ACACAGACCCCACCTTTCAGTGG + Intronic
1079923921 11:26468354-26468376 ACAGTGACTTCACCTTTGAAAGG + Intronic
1080085962 11:28282538-28282560 TAACAGACTTCACCTCTTGATGG - Intronic
1080568750 11:33536645-33536667 ACATAGACACCACCTCTTAATGG + Intergenic
1080613713 11:33927512-33927534 ATATAGTCTTCACCTCTCAATGG + Intergenic
1080856327 11:36114892-36114914 ACACAGTCTGTACCTCTCAAAGG - Intronic
1081646477 11:44793829-44793851 ACACAGCCTCCTCCTCTCCAGGG - Intronic
1081665690 11:44915881-44915903 ACACAGGCTTCTGCTCTCACAGG - Intronic
1082092913 11:48104376-48104398 GCACAGATTTCAACTCTGAAAGG - Intronic
1084509873 11:69596895-69596917 ACCCACACTTCGCCTCTCAGGGG - Intergenic
1084841310 11:71852226-71852248 ACATAGACTTCACCTCTCAGTGG - Intergenic
1085356416 11:75842211-75842233 ACATAGACCTCACTTCTTAATGG + Intronic
1085483207 11:76839596-76839618 ACACAGACTCCACTTCTCAAAGG + Intergenic
1086632120 11:89034224-89034246 ACTCAGACTTCGTATCTCAAAGG + Intronic
1087801902 11:102513519-102513541 ACATAAACTTCATCTCCCAATGG - Intergenic
1088424797 11:109691764-109691786 CCACTTTCTTCACCTCTCAAAGG - Intergenic
1090073412 11:123563299-123563321 ACCCAATCTTTACCTCTCAAGGG - Intronic
1091596427 12:1881991-1882013 ACCCAGAATTCACCTTTCACTGG - Intronic
1092274457 12:7048616-7048638 ACATAGACCCCACCTCTCAATGG + Intronic
1092442300 12:8517157-8517179 AGATAGCCTTCACATCTCAAAGG - Intronic
1092500705 12:9043679-9043701 AAACAGATTTCACCTCTTGAGGG - Intergenic
1092812318 12:12283437-12283459 TCATATACTTCACCTCCCAATGG - Intergenic
1093016564 12:14161335-14161357 ACAAAGACTCCACATCTCAATGG - Intergenic
1094143483 12:27204759-27204781 ACCCAGACACTACCTCTCAATGG + Intergenic
1094418216 12:30240075-30240097 ACAGAGACTCTGCCTCTCAAGGG + Intergenic
1095402202 12:41827789-41827811 ACATAGACTCCAGCTCTCACAGG - Intergenic
1095686631 12:45043211-45043233 AAACAGACCTCACCTTTCAATGG - Intronic
1099066198 12:77982980-77983002 ACAAAGATCTCACTTCTCAATGG + Intronic
1099747198 12:86720396-86720418 AAACAGACTTGACCTCCTAATGG + Intronic
1101526966 12:105539622-105539644 AAACAGGCTCCACCTCTCGATGG - Intergenic
1101554092 12:105790998-105791020 ACACAGACTTCCCCTGTCTCTGG + Intergenic
1101565902 12:105904918-105904940 ACACAGAAATCACCACTCTAAGG + Intergenic
1101962806 12:109262481-109262503 CCAAAGGCTTCACCTCTCAGAGG + Intronic
1102800923 12:115732995-115733017 ACATAGACCTCACCTCTCCATGG + Intergenic
1102893350 12:116579196-116579218 AAATAGACTCCACCTCTCATGGG - Intergenic
1103960311 12:124605366-124605388 ACACAGACTCCACCTCCCATGGG - Intergenic
1104199516 12:126574745-126574767 GCACAGACCCCACATCTCAATGG - Intergenic
1104489087 12:129178804-129178826 ACATAGACTTCACCTCCTGATGG - Intronic
1104880517 12:132067654-132067676 ACACAGCATTCACCTTTTAAAGG - Intronic
1104947406 12:132422281-132422303 GAACAGACTCCACCTCTCAATGG + Intergenic
1105533479 13:21242326-21242348 ACATAGCCTGCGCCTCTCAAAGG - Intergenic
1105629045 13:22142961-22142983 ACATAGATTGCACCTCTCCATGG + Intergenic
1105815774 13:24034932-24034954 AGATAAACTCCACCTCTCAATGG + Intronic
1106156018 13:27157017-27157039 AAACAGACTACTCCTCTCTATGG + Intronic
1106218640 13:27725601-27725623 ACACAGACTGGACATCTCAGAGG + Intergenic
1106358784 13:29010704-29010726 ACACAGTTTTCAGCTCTCAATGG - Intronic
1106873092 13:34042996-34043018 ATACAGGCTCCAACTCTCAATGG + Intergenic
1106978790 13:35253056-35253078 TCACAGACTGCTCTTCTCAAAGG + Intronic
1108353642 13:49610084-49610106 ACAAAGATGCCACCTCTCAATGG - Intergenic
1109984427 13:69959596-69959618 AAAAAGACTTAACATCTCAAAGG - Intronic
1111674299 13:91367982-91368004 ACTCAGACTTTAACTCTTAACGG - Intergenic
1112217663 13:97450443-97450465 ACACAGCTTTCATCTCTCGAAGG - Intronic
1112571457 13:100597261-100597283 ACGCAGACCTCACTTCTCCATGG - Intergenic
1112887225 13:104189143-104189165 ACACAGACTTCATCACTCGCAGG - Intergenic
1113603554 13:111588468-111588490 TCACAGACTTAACCACCCAAAGG - Intronic
1113778621 13:112963136-112963158 GCACAGACGTCCCCTCTGAAAGG + Intronic
1114776280 14:25485736-25485758 AAACAGACTTCACCTCCTGATGG + Intergenic
1117780001 14:59222530-59222552 ACACAGACTTCAACTCGCCAAGG - Intronic
1118878266 14:69803333-69803355 AAATAGACTCCACCTCTAAATGG + Intergenic
1119637082 14:76282571-76282593 ACACAGAATTCAACTCAAAATGG + Intergenic
1120224678 14:81777336-81777358 ACACAGACTTCATCTTGTAATGG + Intergenic
1120915964 14:89710702-89710724 TCACTGACTTCATCTGTCAAAGG + Intergenic
1121008842 14:90508068-90508090 ACAAAGACTCCACTTCTCAAAGG - Intergenic
1121406245 14:93720937-93720959 AGACAGACGTCCCCTTTCAAAGG - Exonic
1121726565 14:96156464-96156486 AGTCAACCTTCACCTCTCAAAGG - Intergenic
1123191281 14:106574718-106574740 ACAGAGTCTTCACCCCTCTAAGG - Intergenic
1123220142 14:106848257-106848279 ACAGAGTCTTCACCCCTCTAAGG - Intergenic
1125226915 15:37405793-37405815 TCACATACCTCACCTCTCAATGG - Intergenic
1125650315 15:41311892-41311914 ACACAGAGTTTCGCTCTCAATGG + Intronic
1126501066 15:49345892-49345914 ACACACACTCAATCTCTCAAAGG - Intronic
1126913236 15:53437025-53437047 ACATAGACCTCACCTCTCAGTGG + Intergenic
1128088281 15:64901027-64901049 ACATAGACCCCACCTCTCCATGG - Intronic
1129420478 15:75421851-75421873 ACACAAGCTTCACTTCTCCAGGG + Intronic
1129662918 15:77563110-77563132 AAACTGACTCCACCTCTTAATGG + Intergenic
1129907496 15:79198861-79198883 ACATGGACTCCACCTCTTAATGG + Intergenic
1129956753 15:79644323-79644345 ACACAGACTCCACCTCTCAGTGG + Intergenic
1134286953 16:12869990-12870012 ACACAGACTCTACCTCTTGATGG - Intergenic
1135145845 16:19962112-19962134 ATACAGACTTCACTACTCCATGG + Intergenic
1135266413 16:21030160-21030182 AAATAGACTTCACCTCTTGATGG - Intronic
1135800835 16:25493648-25493670 ACATAGACTCCACCTCTCTATGG + Intergenic
1135876176 16:26202270-26202292 AAATAGACTCCACCTCTTAATGG - Intergenic
1136596824 16:31256452-31256474 ACACAGATCCCACCTCCCAATGG - Intergenic
1139162502 16:64528051-64528073 ATATAGACTCCACCTCTTAATGG - Intergenic
1139339897 16:66261659-66261681 AGACAGCCTTGACCTCTGAAAGG + Intergenic
1140066395 16:71615126-71615148 ACACTGACTTCCCCTCTAGATGG + Intergenic
1140497042 16:75398392-75398414 ACACAGACTCCCCCTCTAACTGG - Intronic
1140901410 16:79371385-79371407 ACACAGACGCCTCCTCTCAATGG + Intergenic
1141797184 16:86283047-86283069 GCACAGACCCAACCTCTCAATGG - Intergenic
1142794037 17:2293016-2293038 ACACTAACTTCAACCCTCAAAGG + Intronic
1144033174 17:11340577-11340599 AACCAGACTTCACCTCTTGATGG + Intronic
1144706209 17:17369994-17370016 ACACAGAATTCACCACACGAAGG - Intergenic
1145220625 17:21085683-21085705 CAGCCGACTTCACCTCTCAATGG + Intergenic
1147410046 17:40244052-40244074 TCACAGCCCTCTCCTCTCAATGG - Intronic
1147447552 17:40483931-40483953 ACACAGACACCACCTCACTAGGG - Intronic
1148201441 17:45752568-45752590 GCACAGATTCCACCCCTCAACGG - Intergenic
1148347839 17:46915497-46915519 AACTAGACTCCACCTCTCAATGG + Intergenic
1149016264 17:51912155-51912177 ACACCGACTTCAAATCACAAGGG + Intronic
1149431861 17:56600598-56600620 AATTAGACATCACCTCTCAATGG + Intergenic
1149650291 17:58272235-58272257 AGACACATTTCACCTCTCATGGG - Intronic
1150808076 17:68334942-68334964 ACATAGACCCCACCTCTCAATGG + Intronic
1151282299 17:73085721-73085743 ACATAGTGTTCACCTCTCATCGG - Intronic
1151440236 17:74123915-74123937 ACATAGACTCCACCTTCCAATGG + Intergenic
1152486983 17:80600965-80600987 ACAGCAACTTCGCCTCTCAATGG - Intronic
1153898174 18:9588308-9588330 ACAAAGATTTCTCATCTCAAAGG + Intronic
1153971362 18:10229986-10230008 ACACAGGCCTCACCTCTCAGTGG - Intergenic
1155039917 18:22056273-22056295 AAATAGATTTTACCTCTCAATGG + Intergenic
1155740013 18:29277926-29277948 CCAAAGAGTTCACTTCTCAAAGG + Intergenic
1156545302 18:37958035-37958057 ACACAGGCTTCTGTTCTCAAAGG + Intergenic
1156638702 18:39063550-39063572 ACACAGACTTCTACTCACCAAGG - Intergenic
1156885242 18:42128034-42128056 ACACAGACACCACATCTCAGTGG - Intergenic
1157771702 18:50353586-50353608 GGACAAACTTGACCTCTCAAAGG - Intergenic
1159649887 18:70965640-70965662 AAACAGACTCCACCTCTCAATGG - Intergenic
1160139309 18:76306770-76306792 CCCCAGATTTCACCTCTGAATGG - Intergenic
1161976403 19:7610329-7610351 AAAAAGAATTCACCTCTCGAAGG + Intronic
1163969244 19:20776472-20776494 ACAGACACTTCACCTCTCTCGGG - Intronic
1164042742 19:21507818-21507840 ACACAGTCTTAACATCTGAAGGG - Intronic
1164568938 19:29354562-29354584 ACACACACGTCACCTATAAATGG - Intergenic
1164702770 19:30297536-30297558 ACACAGGTGTCACCTATCAAGGG + Intronic
1166594407 19:44032860-44032882 CCACAGTCTTCACATTTCAATGG - Exonic
1166786142 19:45368492-45368514 ACACAGAATTCCCGTCTCAGTGG - Intronic
1166946837 19:46402471-46402493 AAATAGACTTCACCTCTTGACGG - Intergenic
1168497330 19:56864573-56864595 ACACAGACTTCCCGTCTCTTGGG - Intergenic
1168504733 19:56923753-56923775 ACATAGACCCCACTTCTCAATGG + Intergenic
1168633681 19:57976996-57977018 ACACAGACTTCATATTCCAAAGG + Intergenic
925908536 2:8555111-8555133 ACATAAACCTCACTTCTCAATGG - Intergenic
926631422 2:15139946-15139968 AAACAGACTTCACCTCTCTGTGG - Intergenic
929441745 2:41970606-41970628 ACATGGCCTCCACCTCTCAATGG + Intergenic
929731477 2:44498102-44498124 ACACATACTTGAACTCCCAAGGG - Intronic
931190482 2:59995562-59995584 ACACTGATCTCACCTGTCAAGGG + Intergenic
931239814 2:60442163-60442185 TCACAGACTTCATCTCACACAGG + Intergenic
932091371 2:68809055-68809077 AATCAGACTTGTCCTCTCAAGGG - Intronic
932909749 2:75792981-75793003 AAATAGACTTCATCTCTTAATGG + Intergenic
933637642 2:84724922-84724944 ATTTAGACTCCACCTCTCAATGG + Intronic
933813677 2:86049108-86049130 GCACACACTTCACCCCTCTAGGG + Intronic
937138684 2:119578282-119578304 ACATAGACTCCACCTCTAAGTGG + Intronic
937348153 2:121140856-121140878 TAATAGACTCCACCTCTCAATGG + Intergenic
937833631 2:126449447-126449469 AAACAGACTCCACCTCTTGATGG - Intergenic
938315954 2:130328065-130328087 CAGCAGGCTTCACCTCTCAATGG - Intergenic
938848695 2:135238295-135238317 ACATAGATCCCACCTCTCAATGG - Intronic
940364366 2:152830720-152830742 ATACAGACTTCATGTCTTAATGG + Intergenic
940778771 2:157911176-157911198 ACACAGGCTTCTTGTCTCAAAGG - Intronic
940816064 2:158299059-158299081 AAACAGACTTACCCTCTAAAAGG - Intronic
941641212 2:167990850-167990872 AGACAGAGTTCACCTATCACAGG - Intronic
942212162 2:173682000-173682022 ACATAGAATTCACCTCTCCTTGG + Intergenic
945510377 2:210694173-210694195 AAAGAGACCTCACCTCTCAATGG + Intergenic
945918152 2:215726303-215726325 CCACTGAATTCAACTCTCAATGG + Intergenic
946296567 2:218788459-218788481 ACATGGACTTCACCTCTTAATGG + Intronic
946975745 2:225148220-225148242 TCTAAGACTTCACCTCTCACTGG + Intergenic
947145225 2:227058247-227058269 ACACACACTCTATCTCTCAAAGG - Intronic
947293457 2:228603582-228603604 AAATAGACTCCACCTCTGAATGG - Intergenic
947490474 2:230590393-230590415 ACACAGACTCCACCTGTCAATGG - Intergenic
948276394 2:236712290-236712312 ACAGAGAATTCACCTTTCATTGG + Intergenic
948663464 2:239520636-239520658 AAACACACTTCACCCCTCACTGG + Intergenic
1168865250 20:1080717-1080739 GCACAGACTTCACCTCTTGATGG + Intergenic
1169565853 20:6852885-6852907 ACACATACTTCACCTCTTAATGG - Intergenic
1169964264 20:11197368-11197390 ACCCAGACCTCACCTCTTGATGG - Intergenic
1170019043 20:11815504-11815526 ACATAGACTCTAACTCTCAATGG - Intergenic
1170042538 20:12053440-12053462 ACATGGACTTCACCTCTTGATGG + Intergenic
1170052003 20:12156341-12156363 AGGCAGACTCCACCTCTCAGTGG - Intergenic
1170361201 20:15548327-15548349 ACACAGACTCCTCCTCTCAAAGG - Intronic
1170463893 20:16605385-16605407 ACACAGATGCCACCTCTTAATGG - Intergenic
1171158366 20:22897682-22897704 ACCTAGACTCTACCTCTCAATGG + Intergenic
1171308621 20:24127506-24127528 CCATATACCTCACCTCTCAATGG + Intergenic
1172615413 20:36280239-36280261 ACACAGACCTCACCTCTCAATGG + Intergenic
1173121878 20:40300284-40300306 ACACAGACACCACCTCTTGATGG + Intergenic
1173176805 20:40771000-40771022 ACACAGCCCCCACCTCTCATGGG - Intergenic
1173200809 20:40953844-40953866 AAATAGACTTCACCTCTTGATGG - Intergenic
1173327636 20:42048329-42048351 ACACAGAGCCCACCTCTCATTGG - Intergenic
1173424667 20:42932287-42932309 AGGCAGACATCACTTCTCAAGGG + Intronic
1173513875 20:43651157-43651179 ACAGAGACCCCACCTCTCAATGG - Intergenic
1173538043 20:43830764-43830786 ACATAGACTTCACCTCCTGATGG - Intergenic
1173736756 20:45367213-45367235 ACAGAGACTTCACATTTCCAGGG - Exonic
1175298958 20:57929170-57929192 ACATGAACTTTACCTCTCAATGG + Intergenic
1178151920 21:29804958-29804980 AGACTAACTTCACCTCTTAAAGG + Intronic
1178174407 21:30079615-30079637 AAACAGACTCCATCTCTTAAAGG + Intergenic
1179059508 21:37966502-37966524 TCACAGGCTTCCCCTCTCACTGG + Intronic
1179212816 21:39340015-39340037 AAACCGACTTCAACTGTCAAAGG - Intergenic
1180029231 21:45192395-45192417 ACAGAGACGTCACCTCTTAATGG - Intronic
1180717487 22:17881649-17881671 ACACAGAGACCCCCTCTCAAGGG + Intronic
1182517430 22:30867040-30867062 ACACACACACCACCCCTCAAGGG - Intronic
1182692714 22:32175255-32175277 ACACAGACGTCGCCTCCCAATGG + Intergenic
1182787685 22:32921134-32921156 AGACAGAATTCACCCCTAAATGG - Intronic
1183252347 22:36738973-36738995 ACACAGACCCCACCTCTTGATGG + Intergenic
1184451169 22:44583747-44583769 AAGCAGATTTCACCTTTCAAGGG - Intergenic
949127293 3:461424-461446 ATAGAGACATCACCTTTCAATGG + Intergenic
950620025 3:14197601-14197623 ACCCAGGCTTCACCTATCAGTGG + Intronic
951136895 3:19114396-19114418 AGAAAGACTCTACCTCTCAAGGG + Intergenic
951231270 3:20182270-20182292 TCACTGACTTCTCCTGTCAATGG + Intronic
951274928 3:20673381-20673403 ATACGGACTCCGCCTCTCAATGG + Intergenic
952314381 3:32219861-32219883 ACATAGACTTCACATCTTGATGG + Intergenic
952509012 3:34035621-34035643 AGATAGACCCCACCTCTCAATGG + Intergenic
952567482 3:34676444-34676466 AAAGAGATTTCACCTCTTAATGG - Intergenic
952750723 3:36822737-36822759 AGACAGACTCCACCTCTGGATGG + Intergenic
952977589 3:38709252-38709274 ACTCAGGATTCACATCTCAAAGG - Intronic
952983850 3:38760107-38760129 AAATAGACTTCATCACTCAATGG - Intronic
953129427 3:40124141-40124163 ACTTAGACTTCACCTCTCAGAGG + Intronic
953582516 3:44169774-44169796 ATACAGCCTTCAGCACTCAAGGG + Intergenic
953696455 3:45163854-45163876 ACACAGACTTCACCTGTACATGG + Intergenic
953781454 3:45874691-45874713 AGACAGACACTACCTCTCAATGG - Intronic
954734123 3:52690972-52690994 AAGCAGACTTCACTTCTGAATGG - Exonic
955753476 3:62205418-62205440 ACACAGACTTCTCTTCTCTTGGG + Intronic
956209114 3:66785198-66785220 AAACAGACTCCACCTGTTAATGG + Intergenic
958512643 3:95068170-95068192 ACACAGCCTTCAACTTACAATGG + Intergenic
958597541 3:96247106-96247128 ATACAGACTCTACCTCTCAAGGG + Intergenic
958692434 3:97484913-97484935 ACACAGTATTCACATCTCAATGG + Intronic
958893861 3:99808835-99808857 ACACAGATCCCACCACTCAATGG + Intergenic
959414852 3:106071852-106071874 CAACTGGCTTCACCTCTCAACGG - Intergenic
959691909 3:109206862-109206884 AACTAGACTTCACCTCTCAATGG - Intergenic
960151070 3:114249443-114249465 ACATGGACCACACCTCTCAATGG - Intergenic
961022453 3:123520080-123520102 ATACAGGCCTCACCTCTCAGAGG - Intronic
961575583 3:127833390-127833412 AACTAGACTTCACCTCTCGATGG - Intergenic
961864975 3:129947098-129947120 ACATAGACCCCACCTCTCGATGG - Intergenic
962387747 3:134946393-134946415 ACACAGCCTTCATTCCTCAATGG + Intronic
962567367 3:136675238-136675260 AAACAGTCTTCACATCTTAATGG - Intronic
962686590 3:137853741-137853763 ACACAGACCTCACCACCTAATGG + Intergenic
962869044 3:139472367-139472389 ACATAGACCCCACCTCTCAGTGG - Intronic
962883148 3:139598259-139598281 ACACAGACTTCACCTCTCAATGG - Intronic
963076936 3:141355703-141355725 ACACAGACTTCCCATCTTAGGGG + Intronic
964081025 3:152757013-152757035 ACAGAGAATTGACCTCACAAAGG - Intergenic
964732472 3:159882084-159882106 AAATAGACTCCACTTCTCAATGG + Intronic
965181157 3:165405024-165405046 AGACAGACTTCATCTGTCTAGGG + Intergenic
966664328 3:182454035-182454057 AAATAGACTCCACTTCTCAATGG - Intergenic
967062065 3:185881427-185881449 AGAGAGACTTCCCCTCCCAAGGG + Intergenic
968617487 4:1584907-1584929 AGACAGACTTCACCTTTCAGTGG + Intergenic
969361721 4:6668334-6668356 ACACAGACTCCACCTCTTGATGG + Intergenic
969782404 4:9418266-9418288 ACATAGACTTCACCTCTCAGTGG - Intergenic
970519571 4:16868627-16868649 ACCCACACTTCTCCTTTCAAAGG + Intronic
971220388 4:24700321-24700343 ACACAGACCACACCTCTCTGTGG - Intergenic
972491060 4:39587605-39587627 GGCCAGATTTCACCTCTCAATGG - Intronic
972689326 4:41381545-41381567 AAACAGACTCCACCTCTTCAGGG - Intronic
973848563 4:54937966-54937988 ACACAACCTTCTACTCTCAAGGG - Intergenic
973941682 4:55917303-55917325 ACATAGACTCTACCTCTCAATGG + Intergenic
974367277 4:60966786-60966808 ACACAGTTTTCACCTATCACAGG + Intergenic
974903128 4:68025419-68025441 ATACAGAATTCACATCACAATGG + Intergenic
975430138 4:74280168-74280190 ACAGAGACTCCACTTCTCAATGG - Intronic
975493554 4:75014062-75014084 TCTCAGTCTTCACCTCTCACAGG - Intronic
976703948 4:88002349-88002371 ACTCAGACTTCATCTCTCCCTGG - Intergenic
976734724 4:88297849-88297871 AAATAGAATTCACCTCTCGATGG - Intergenic
977570061 4:98620078-98620100 ACATAGACCTCACCTCTCAGTGG - Intronic
979506884 4:121509309-121509331 CCACTGACTTCACCTCTCGGAGG + Intergenic
980057327 4:128090465-128090487 ACACAGACACAACCACTCAATGG - Intronic
980632594 4:135455234-135455256 ACACAGAATACACCTCTTACTGG - Intergenic
981024929 4:140068171-140068193 ACATAGACCTCACCTCTCAATGG + Intronic
981175028 4:141671838-141671860 AGAGAGACTCCACCTTTCAATGG + Intronic
981873659 4:149516072-149516094 ACACAGACTTCTGCTCACCAAGG + Intergenic
982810039 4:159813893-159813915 ACATAGAGTTCACCTCAGAAAGG + Intergenic
983328395 4:166290116-166290138 AAACAGACTTCATTTCTCAAAGG + Intergenic
983593181 4:169437466-169437488 AAACAGAACCCACCTCTCAATGG - Intronic
983875826 4:172873496-172873518 ACACAGACCCCACTTCTCAATGG + Intronic
984892875 4:184509077-184509099 ACATAGACTTCACCTCTTGATGG - Intergenic
986041334 5:3996872-3996894 ACAAAGAGTTCACTTGTCAAAGG + Intergenic
986091089 5:4507631-4507653 ACACTAACTTGACCTCACAAGGG - Intergenic
986092902 5:4528277-4528299 ACACAGACGTCTCATCTCCATGG - Intergenic
986370426 5:7074520-7074542 ACACAGACCTCACCTCACAGTGG - Intergenic
988881984 5:35514106-35514128 ACACAGACTTCACTTCTCAATGG - Intergenic
990221654 5:53597385-53597407 ATACAGACTTCAGCTCTTAATGG + Intronic
990622798 5:57578660-57578682 ACAAAGAATTCACCTCTCTGAGG - Intergenic
990675241 5:58176924-58176946 ACACAGGCTTTACCCTTCAATGG - Intergenic
991913402 5:71583557-71583579 ACATAGACCCCACCACTCAATGG - Intergenic
992374850 5:76178269-76178291 ACATAGACTTCACCTTTTCATGG + Intronic
993196429 5:84752977-84752999 ACACATACTACTCCTTTCAAAGG - Intergenic
993727947 5:91389906-91389928 ACACACACTGGACCTTTCAAAGG + Intergenic
993886893 5:93425465-93425487 AGAGAGACTCCACCTCTTAATGG + Intergenic
994096807 5:95854565-95854587 ACATAGACATCACCTCTGGATGG + Intronic
994495840 5:100512349-100512371 AAATACAATTCACCTCTCAATGG - Intergenic
995849930 5:116534358-116534380 ACACAGACTCCACATCTACATGG + Intronic
997603600 5:135156985-135157007 ACACAGATGTCAACTGTCAAGGG - Intronic
997756173 5:136401248-136401270 AAATAGACTTCACCCCTCAATGG - Intergenic
997885846 5:137629375-137629397 CCACAGACTTCTCCACTCCATGG + Intronic
998613623 5:143716260-143716282 AAATAGAATTCACCTTTCAATGG - Intergenic
998691786 5:144595426-144595448 CCAGAGGCTTCACCTCTCACTGG - Intergenic
999568716 5:152894455-152894477 ACATATATTCCACCTCTCAAAGG - Intergenic
999896674 5:156041689-156041711 ACACATGCCTCACTTCTCAAAGG - Intronic
1000642642 5:163720842-163720864 ACACAGACTTCAACTATATAAGG - Intergenic
1000681303 5:164188395-164188417 ACACAGACTAAACCTCCCAGTGG - Intergenic
1001717832 5:173831517-173831539 AAACGGAATTCACCTCTTAATGG - Intergenic
1002462181 5:179379617-179379639 AAACTGGCTTCACCTCTAAAGGG - Intergenic
1004815372 6:19306779-19306801 ACACAGACTTACCTTCTCTAAGG - Intergenic
1005111671 6:22288568-22288590 ACACAGCCCTCACCACTGAAGGG - Intronic
1006499349 6:34448118-34448140 ACACAGACTCCGCCTCCCAGTGG + Intergenic
1008069094 6:47081117-47081139 ACACAGACTTCACCACTCAGTGG + Intergenic
1008420499 6:51293818-51293840 ACACAAACCTCACCACTGAATGG - Intergenic
1010779067 6:79922505-79922527 ATACAGAGGTCACCTCTCACTGG - Intronic
1010789380 6:80047432-80047454 AGACAGACTTCACCTCTTAATGG + Intergenic
1011949273 6:92944144-92944166 AAATAGACTTCATCTCTTAACGG - Intergenic
1011985570 6:93439784-93439806 ACACTGACTCCATCTCTCAATGG - Intergenic
1012262048 6:97099226-97099248 ACCCAGACTGCACCCCTCAACGG + Intronic
1012661314 6:101897671-101897693 GCACAGACTTCACTTTTTAAAGG - Intronic
1013733472 6:113198785-113198807 ACAGAAACCCCACCTCTCAATGG - Intergenic
1014436390 6:121425307-121425329 ACTCTGACTTCACCTCTGAGAGG + Intergenic
1014681050 6:124430789-124430811 ACATATACTCCACCTCTCAATGG + Intronic
1015140024 6:129920457-129920479 ACTTAGACTCCACCTCTCAGTGG - Intergenic
1015567154 6:134585472-134585494 CCTCAGACACCACCTCTCAATGG - Intergenic
1016413123 6:143804482-143804504 AGACAGACTTCACCTCTTGATGG + Intronic
1016594647 6:145785756-145785778 ACACAGACTTCCACTCACAAAGG + Intergenic
1017636652 6:156450681-156450703 ACACACACTCCACCCCACAAGGG + Intergenic
1018480392 6:164183901-164183923 GCACACACTTCTGCTCTCAAGGG - Intergenic
1018502563 6:164426761-164426783 ACATAGACACCACCTCTGAATGG + Intergenic
1018915304 6:168129194-168129216 ACACAGACTTCGCCTCTCAGTGG + Intergenic
1019595012 7:1854415-1854437 AAACAGAGTTCACTTCTCACAGG + Intronic
1019610181 7:1932590-1932612 ACACAGAGGTCACTTGTCAAAGG - Intronic
1020550821 7:9602317-9602339 ACACACACATCTCCCCTCAATGG + Intergenic
1021697517 7:23288728-23288750 ACATAGACCCCACCCCTCAATGG + Intergenic
1023877670 7:44296690-44296712 AAAAACACTTCACCTGTCAAGGG + Intronic
1023916169 7:44590967-44590989 AAATAGACTCCACCCCTCAATGG - Intergenic
1026245571 7:68616550-68616572 ACACAGAGCTCACATCTCAGTGG + Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1026512820 7:71041139-71041161 ACACAGATTTATCCTCTCACAGG - Intergenic
1027582601 7:80017499-80017521 AGACAGACTTCACCAGACAAAGG + Intergenic
1028358067 7:89933698-89933720 ACTCACACCTCAACTCTCAATGG - Intergenic
1028528885 7:91816402-91816424 ACATAGACTCCATCTCTCAATGG + Intronic
1028679483 7:93509044-93509066 ACATACACCCCACCTCTCAATGG - Intronic
1028776400 7:94682124-94682146 ACACAGACTCCACTTCTCAGGGG - Intergenic
1030210883 7:106994696-106994718 ACACAGTCCTCACCTCTCAATGG - Intergenic
1034401872 7:150867294-150867316 ACATAGACCCCACATCTCAATGG + Intergenic
1034686335 7:152974541-152974563 AAATAGACTTCCTCTCTCAATGG + Intergenic
1036772203 8:11587084-11587106 GCACAGACAGCACCTCTCATAGG - Intergenic
1036836656 8:12075862-12075884 ACATAGACTTCACCTCTCAGTGG + Intergenic
1036858499 8:12322429-12322451 ACACAGACTTCACCTCTCAGTGG + Intergenic
1038042163 8:23732836-23732858 AAATAGACTCTACCTCTCAATGG + Intergenic
1038921495 8:32090087-32090109 ACATAGAGTCCACCTCTTAAAGG + Intronic
1042169194 8:65975799-65975821 ACACACACTAAACCTCTCACAGG - Intergenic
1043549711 8:81356779-81356801 ATACAGACTTCACCTCCTAATGG - Intergenic
1044559505 8:93598537-93598559 TCACAGACCCCTCCTCTCAATGG + Intergenic
1045429399 8:102098890-102098912 ACACTGACTTCATCTCTCACTGG + Intronic
1047178633 8:122566407-122566429 AATTAGACCTCACCTCTCAATGG + Intergenic
1047694743 8:127392310-127392332 GCACAGCCTTCAGCACTCAATGG - Intergenic
1047813032 8:128430821-128430843 ACAGAGACCCCACCTCTTAATGG - Intergenic
1048124925 8:131623982-131624004 TCCCAGACTTTACCTATCAATGG + Intergenic
1048874295 8:138824902-138824924 AGACAGACTTCATCTCTCCATGG + Intronic
1049252048 8:141594442-141594464 ACACAGACTCAACCTCTCTCTGG - Intergenic
1050207733 9:3214890-3214912 ACACAGACTTCCCCTCACCAAGG + Intergenic
1051055666 9:12982336-12982358 AAACAGACTTCATCTTTGAATGG + Intergenic
1051681747 9:19614548-19614570 AATTAGACTTCACTTCTCAAAGG - Intronic
1052400831 9:27998108-27998130 AAACAGACCTTACCTTTCAAGGG - Intronic
1055031121 9:71772050-71772072 ACACAGACTTCTCTGATCAATGG + Intronic
1055117876 9:72625061-72625083 ACAAAGACATCACCTCTTGATGG - Intronic
1055644581 9:78350655-78350677 AAACAGACTCCACCTCTTGATGG + Intergenic
1056217653 9:84420118-84420140 AAAGAAACTTCACCTATCAAGGG + Intergenic
1056511357 9:87309144-87309166 ACAAAGACCCCACCTCTCAATGG - Intergenic
1056793823 9:89642831-89642853 ACAGAGAGCTCACCTCTCAGTGG - Intergenic
1056873213 9:90304312-90304334 ACACAGACCTCATCTCTCAATGG - Intergenic
1057569880 9:96196529-96196551 AATCAGACTCCACTTCTCAATGG + Intergenic
1057798859 9:98177105-98177127 AAACACAGTTCACCTTTCAAAGG - Intronic
1058210169 9:102158450-102158472 ACAAAGATCTCACCACTCAAAGG + Intergenic
1058241434 9:102566518-102566540 ACACAGACTAAAGCTCCCAAAGG - Intergenic
1058958317 9:109969655-109969677 ACACAGACTTCAGCCCTGAAGGG - Intronic
1058965859 9:110037836-110037858 ACTCATACTTAACCTCTCCACGG - Intronic
1060626724 9:125120089-125120111 ACACAGGCTTCACCACTAGATGG + Intronic
1060912720 9:127363544-127363566 ACACAGCCTTCACCTCTAAAAGG - Intronic
1186721924 X:12313669-12313691 ACAAAGACTTACCCTTTCAAAGG - Intronic
1186771772 X:12825426-12825448 ACACAGACTTCACCACTTACCGG + Intergenic
1187242503 X:17526554-17526576 AAATAGACTCCACCTCTCGATGG + Intronic
1187355927 X:18571608-18571630 ACACAGGCTTCTCTTCTCAGAGG - Intronic
1188299369 X:28488883-28488905 ATATAGACCCCACCTCTCAATGG - Intergenic
1188386310 X:29563720-29563742 ACACAAACCTCACTTCTGAACGG + Intronic
1189050195 X:37636771-37636793 AAACAGTCTTCACCTTTAAAAGG - Intronic
1189069755 X:37850873-37850895 ACACATAATCCACTTCTCAATGG + Intronic
1189257062 X:39648527-39648549 ATATAGACTCCACCTCTTAATGG - Intergenic
1189373200 X:40446112-40446134 ACACAGATGACACCTCTCTATGG + Intergenic
1189589009 X:42492287-42492309 ACATAGACCCCACCACTCAATGG - Intergenic
1189799070 X:44675370-44675392 AAACAGACTCCACCTCTAACGGG - Intergenic
1189859986 X:45262156-45262178 ACTGAGACTCCACCTCTTAATGG - Intergenic
1191997391 X:67110293-67110315 ACACAGACTTCACCAGTGATAGG + Intergenic
1192102171 X:68276649-68276671 ACATAGACCTCACCTCTCAATGG - Intronic
1192772306 X:74205682-74205704 CCACAGACTTCAACCCTGAAGGG + Intergenic
1193576775 X:83208844-83208866 ACCTAGATTTCTCCTCTCAAGGG - Intergenic
1195458187 X:105093207-105093229 ACACACACCTCAACTCACAAAGG + Intronic
1197344919 X:125319640-125319662 ACACACACTTCTGCTCTGAAAGG - Intergenic
1197885739 X:131216391-131216413 ATGTAGAATTCACCTCTCAAAGG + Intergenic
1197896361 X:131319708-131319730 ACATAGATTCCACTTCTCAATGG + Intronic
1198319886 X:135510308-135510330 ACACAGACCCCACCTCCCAGTGG + Intergenic
1198483685 X:137065180-137065202 ACATAGATCCCACCTCTCAATGG - Intergenic
1198483930 X:137067468-137067490 ACATAGACTCCACCTTTCAACGG + Intergenic
1199090459 X:143685977-143685999 ACATAGCCCCCACCTCTCAACGG + Intergenic
1199305912 X:146267584-146267606 ACACAGTCTCTACCTCTAAAGGG + Intergenic
1202069705 Y:20978310-20978332 CCACAGCCTTCACCTCTGAGGGG + Intergenic