ID: 962883453

View in Genome Browser
Species Human (GRCh38)
Location 3:139600836-139600858
Sequence GATTCTAATGCTCCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962883453 Original CRISPR GATTCTAATGCTCCAAAAGC AGG (reversed) Intronic
910616400 1:89203533-89203555 GATACAAAGGCTCCACAAGCAGG - Intergenic
912057197 1:105617694-105617716 GATTTTAATGATACAAAAGTTGG + Intergenic
912489153 1:110052020-110052042 CATCCTGATGCTACAAAAGCAGG - Intronic
918292324 1:183120940-183120962 CATTCTTTTGCTACAAAAGCAGG - Intronic
921865029 1:220079779-220079801 TATTCTATTGCTCAAAAGGCAGG - Exonic
921972792 1:221168619-221168641 GATACTGCTGCTCTAAAAGCAGG + Intergenic
924103342 1:240626358-240626380 AATTCGAATGTTCCAAAATCCGG - Intergenic
1065514017 10:26506793-26506815 GACTCTAACTCTCCACAAGCAGG - Intronic
1072439094 10:95438281-95438303 TATTCTATTTCTCCAAATGCTGG + Intronic
1073870303 10:107855497-107855519 GATGCTAATGCTACAAAGGGAGG + Intergenic
1075902370 10:126053342-126053364 GATTGTAATGCCCCAAATGCTGG + Intronic
1079883337 11:25954052-25954074 GATGATAATGCTACAAAAGTAGG + Intergenic
1081392501 11:42545415-42545437 CAATCTAATTGTCCAAAAGCAGG + Intergenic
1086886164 11:92208336-92208358 GATCTTAATGCTCCAAAATGAGG + Intergenic
1087304813 11:96475907-96475929 GATTCTAATGCAGTAATAGCTGG + Intronic
1092736769 12:11590111-11590133 GATTGTAAATCTTCAAAAGCTGG - Intergenic
1093771725 12:23025767-23025789 GATTCAAATGCTTTAACAGCAGG - Intergenic
1095601176 12:44014498-44014520 GATGCTGATGCTCCTAAATCTGG + Intronic
1100108302 12:91205550-91205572 TATTCAATTTCTCCAAAAGCAGG + Intergenic
1100246260 12:92760232-92760254 GATTCTACTGCTACAAGAGAAGG + Intronic
1101862274 12:108492832-108492854 CAATCTCATGCTCCAAAAGAGGG + Intergenic
1110028548 13:70574063-70574085 CATTCAAATAATCCAAAAGCTGG - Intergenic
1112626888 13:101115100-101115122 TATTTTCATGCTTCAAAAGCAGG - Intronic
1112829240 13:103428241-103428263 GAGACTAGAGCTCCAAAAGCTGG - Intergenic
1116530130 14:45961256-45961278 TATTCAAATGATCCAAAAGAAGG - Intergenic
1121388652 14:93555003-93555025 GAATCTAATGGCCCCAAAGCAGG + Intronic
1121573467 14:94964708-94964730 GAATCTCAAGCTCCCAAAGCTGG + Intergenic
1125594694 15:40877089-40877111 AATTCTATTTCTCCAAGAGCTGG + Intergenic
1129394082 15:75234851-75234873 GCTTCTAAGGCTTCAGAAGCAGG + Intergenic
1130348544 15:83069863-83069885 GAGTATAATGCTCCACAATCTGG + Intergenic
1130641128 15:85676467-85676489 GCAGCTAAAGCTCCAAAAGCAGG - Intronic
1131122923 15:89834219-89834241 GGTTCTCATGCTCCAGAAGCTGG + Exonic
1134669759 16:16046107-16046129 CATCCTACTGCTCCAGAAGCTGG - Intronic
1138855087 16:60681231-60681253 GTTTCTAATTCTCTAAAGGCGGG - Intergenic
1141374251 16:83515020-83515042 GACCCTAAACCTCCAAAAGCTGG - Intronic
1147119600 17:38328209-38328231 GATGCTGATGGACCAAAAGCTGG - Exonic
1148669126 17:49397257-49397279 GCTTCAAATGCTCCAATATCTGG - Intronic
1148825199 17:50387984-50388006 GATTCTCATGCTTCAGGAGCTGG - Intronic
1149145570 17:53488347-53488369 GTTTCTAATGGTACAACAGCTGG - Intergenic
1149647009 17:58248290-58248312 AATTCCAAAGCTCCAAAAGAAGG + Intronic
1155139021 18:23026698-23026720 GATTCCAATTCAACAAAAGCTGG - Intergenic
1158118231 18:54020534-54020556 TATTCTAAAGCTCCACAAGACGG - Intergenic
1158435120 18:57430157-57430179 GATGCTAACGCTGCAGAAGCTGG - Intergenic
1158747353 18:60216596-60216618 TATTCTTGTACTCCAAAAGCAGG - Intergenic
1159349239 18:67250311-67250333 AATTATAATGGTCCTAAAGCAGG + Intergenic
1160003439 18:75049460-75049482 GATTCTAGAACTCCCAAAGCAGG - Intronic
1161526491 19:4759355-4759377 GCTTCTTATGCCCCAGAAGCAGG - Intergenic
925652815 2:6109886-6109908 GATTCAAATGCAGCAAAAGGAGG - Intergenic
926861496 2:17315014-17315036 GATTCCAAGGCTCCAGAATCAGG + Intergenic
928094421 2:28394878-28394900 GATGCTCATGCTCCATAAGGCGG + Intronic
932317570 2:70796063-70796085 AATTCAAATGCTCCAAATCCAGG - Intergenic
935575093 2:104701124-104701146 GATTAAAATGGTCCAACAGCGGG + Intergenic
937468212 2:122153410-122153432 GATACTAATTCTTCAAAACCTGG + Intergenic
946758767 2:222972669-222972691 GATTCTAATGGGGGAAAAGCCGG + Intergenic
948343955 2:237279651-237279673 GATGCTGATGCTACAAAAGACGG + Intergenic
1168781647 20:496682-496704 ATTTCTAAGGCTCCAACAGCAGG + Intronic
1172821521 20:37739017-37739039 GACTCTAATGCTGGATAAGCTGG - Intronic
1173365615 20:42382068-42382090 GATTCTAATGTTCAGAAAGTAGG - Intronic
1175334078 20:58183870-58183892 GATGCTAATGCTCTAAGAGCTGG + Intergenic
1179228416 21:39477050-39477072 GATTCTAATGCTATAAAAAAAGG - Intronic
1179665582 21:42910012-42910034 GTTTCTAATGATCAAAAACCAGG - Intronic
1182087609 22:27572212-27572234 GATTCTGCTGCTCCAAAGGGAGG - Intergenic
1183325749 22:37192470-37192492 GAATCTAATGGCCCCAAAGCAGG + Intronic
951209458 3:19958727-19958749 AATTCTAATGCCTCAATAGCTGG - Intronic
951817810 3:26774294-26774316 GATTATGATTCTCCAAAAACTGG + Intergenic
952257566 3:31708775-31708797 GTGTCTAATTCTCCAAAAGTAGG + Intronic
952374672 3:32756161-32756183 GATTGTAATGCACCAAGAGAAGG + Intronic
953810125 3:46105002-46105024 TCTCCTAATGCTGCAAAAGCAGG + Intergenic
954877635 3:53812969-53812991 GGTTCTAATTATCCAAAAGTGGG - Exonic
955535035 3:59914395-59914417 GACTCTATGTCTCCAAAAGCAGG + Intronic
962883453 3:139600836-139600858 GATTCTAATGCTCCAAAAGCAGG - Intronic
964856828 3:161154906-161154928 GATTCAAATGGTCCAAGAGCAGG - Intronic
966627139 3:182029821-182029843 TATTCTAATACTCCAAGTGCTGG + Intergenic
974750784 4:66138116-66138138 GCTTCTGATGTTCCAAATGCTGG - Intergenic
980152182 4:129061268-129061290 TATTCTGATGCCCCCAAAGCTGG - Intronic
983225728 4:165084583-165084605 GATTATATAGATCCAAAAGCAGG + Intronic
988404593 5:30807708-30807730 GATTCTGGTCCTCCAAAAGCAGG + Intergenic
990500202 5:56389074-56389096 GATTCTAATGCTTCCAAATGAGG + Intergenic
993287439 5:86016994-86017016 GATTCTCAAGCTCCAAAACATGG + Intergenic
998260473 5:140627361-140627383 GAATCTAATGGTTCCAAAGCAGG + Intergenic
998870649 5:146548367-146548389 GATTCTACTGCACCACGAGCAGG - Intergenic
999083214 5:148863762-148863784 AACTCTGAAGCTCCAAAAGCTGG - Intergenic
1002334125 5:178466424-178466446 GATTCTAAGGCTTCCTAAGCTGG + Intronic
1003416056 6:5909243-5909265 GATTCTAAAGAACCAAAAGCTGG + Intergenic
1004126215 6:12876513-12876535 GTTTTTAATGCTCCAAAGGCAGG - Intronic
1004973731 6:20941254-20941276 ATTTCTAATGCTACTAAAGCTGG + Intronic
1008567730 6:52785949-52785971 GATTGTAATGCTCCAAAGGGAGG - Intergenic
1017684104 6:156894654-156894676 GATTCTTTTCCTCCAAAAGGAGG + Intronic
1017740582 6:157403265-157403287 TATTGTCATGCTCCACAAGCTGG + Intronic
1017850836 6:158304345-158304367 GATTCTAATATCCTAAAAGCAGG + Intronic
1019545457 7:1572607-1572629 GGTTCTAATACTCAAAAAACAGG + Intergenic
1021666585 7:22987793-22987815 AATTCTAATTCTCCCCAAGCTGG - Intronic
1024506158 7:50163778-50163800 GATTCTCATACTCTAAAACCAGG - Intergenic
1027139297 7:75645994-75646016 GATTCTAATGATCCATCATCCGG - Intronic
1028909523 7:96192440-96192462 GATTCTGGTGCTCCACGAGCAGG + Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1030693979 7:112564316-112564338 GATGTGAATGCTGCAAAAGCAGG - Intergenic
1031654472 7:124335921-124335943 GATTCTAATGCTTGAAAACATGG + Intergenic
1033578021 7:142704661-142704683 GATTCTAATCCTCCTAAATCGGG - Intergenic
1035126653 7:156612600-156612622 GATTCTGATGCAGCTAAAGCTGG - Intergenic
1035270163 7:157715077-157715099 GATTCAAGTGCTCAGAAAGCAGG - Intronic
1036563536 8:9918594-9918616 GACACTAATGCTGCAAATGCAGG + Intergenic
1039541155 8:38372088-38372110 GGTTCCAATACTGCAAAAGCAGG + Intronic
1042648267 8:71011218-71011240 GATTTTCATTCTCCAAGAGCAGG + Intergenic
1045284813 8:100781402-100781424 GATTCTAATACCATAAAAGCAGG + Intergenic
1046526241 8:115385427-115385449 GATTCTAAGGCCTCAGAAGCAGG + Intergenic
1048293313 8:133196790-133196812 GATTCTATTGTTCCAATAGCAGG + Intronic
1048738205 8:137525342-137525364 GATTCTAGTGCAGCAAAAGTAGG - Intergenic
1051200760 9:14620481-14620503 CATTCAAATACACCAAAAGCTGG + Intronic
1052216225 9:25969346-25969368 GATTCTATTGCTTCACATGCTGG - Intergenic
1057370170 9:94464033-94464055 AATTCTAATGATACAAAAGTTGG - Intergenic
1189740985 X:44117016-44117038 GATTCTGATGCCCCTAAAGTTGG - Intergenic
1192102216 X:68276996-68277018 GATTCTTCTGCTCCAAATGATGG - Intronic
1192725064 X:73741187-73741209 TATTTTAAAGCTCTAAAAGCAGG - Intergenic
1193179559 X:78438591-78438613 GAATCTAATGGTTCTAAAGCAGG + Intergenic
1194670743 X:96729318-96729340 GATGCTACTACTCTAAAAGCTGG + Intronic
1194877976 X:99213118-99213140 GATTCTATTGCTGCAAGTGCGGG + Intergenic
1198787103 X:140300715-140300737 GTTTCTTATGCTCCAAAACCAGG - Intergenic