ID: 962883587

View in Genome Browser
Species Human (GRCh38)
Location 3:139601857-139601879
Sequence CCTACAATGTTGAAGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962883587 Original CRISPR CCTACAATGTTGAAGGCAGA TGG Intronic
901481801 1:9530318-9530340 CCCAAACTGTTGAGGGCAGATGG - Intergenic
902108282 1:14056322-14056344 TCTTCCATGATGAAGGCAGAAGG + Intergenic
903779684 1:25813341-25813363 CCCACAGTGAGGAAGGCAGAAGG + Intronic
903844205 1:26267788-26267810 TCTACTATGGGGAAGGCAGAGGG - Intronic
905508941 1:38503204-38503226 CCTACAAGGGAGGAGGCAGAAGG - Intergenic
906206660 1:43990907-43990929 CCTACAATGTTGAATGAAAAAGG - Exonic
906412309 1:45588496-45588518 CCTGCACTTTGGAAGGCAGAAGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908924329 1:69235756-69235778 CCTACTATGTTGCAGGCATAAGG - Intergenic
911844683 1:102736469-102736491 CCTACAAAGTTGAATGTAGAAGG + Intergenic
912430517 1:109626223-109626245 CCTACAGTGAGGAGGGCAGAGGG + Exonic
914384157 1:147151381-147151403 CTTACATGGTAGAAGGCAGAGGG + Intergenic
916854555 1:168736590-168736612 CCTACAATCCTGAAGGCAGGTGG + Intergenic
917687171 1:177428709-177428731 TCTACAGAGGTGAAGGCAGAAGG - Intergenic
917921052 1:179750221-179750243 GATACAATGTTGGAGGCAGGGGG + Intronic
921007982 1:211112800-211112822 TCTATACTGTTGGAGGCAGACGG - Intronic
921263407 1:213403403-213403425 CCTAAAGGGATGAAGGCAGAGGG - Intergenic
921701673 1:218275494-218275516 CCTAGAAAGATGGAGGCAGACGG + Intergenic
923749181 1:236731293-236731315 CCTAAAATGTTGGATGCTGAAGG + Exonic
1063604888 10:7514433-7514455 TCTACAATGCTGATGTCAGAGGG + Intergenic
1065008981 10:21404788-21404810 CCTAAAGAGTTGAAGTCAGAAGG + Intergenic
1065943475 10:30586200-30586222 CCCTCACTGTTGAAAGCAGAGGG + Intergenic
1066010066 10:31186895-31186917 CCTACCATGTTCAAGGGACATGG + Intergenic
1068291638 10:55009434-55009456 CCTAAAATGTTGGTGGTAGATGG - Intronic
1074749767 10:116573529-116573551 CCTACAATGTTACAAGCACAGGG - Intergenic
1081120921 11:39264979-39265001 TATACAATGTTGCAGCCAGATGG - Intergenic
1081495512 11:43606094-43606116 CCTAAAATATTCAAGGTAGAAGG + Intronic
1082808678 11:57465480-57465502 CCTAGGCTTTTGAAGGCAGAGGG - Intronic
1083393674 11:62373758-62373780 TCTATAATGTTGCAGCCAGAAGG - Intronic
1086047924 11:82554529-82554551 CCTCCAAATTTGAAGACAGAAGG + Intergenic
1086373943 11:86181578-86181600 CCTGGCATGTTGAAGGAAGATGG + Intergenic
1086911498 11:92477961-92477983 CCTTCAGTGTAGAAGCCAGAAGG + Intronic
1089482848 11:118821083-118821105 GCTACAAGGTTGAAGGTAGAGGG - Intergenic
1090239993 11:125175112-125175134 CCTACAATCTAGAAGTCAGCAGG - Intronic
1090332055 11:125940011-125940033 CCCACATAGTGGAAGGCAGAAGG - Intergenic
1090950673 11:131470513-131470535 GCTACTGTCTTGAAGGCAGATGG + Intronic
1092795627 12:12107848-12107870 CCTCCACCGTTGAGGGCAGAGGG + Intronic
1092907795 12:13117781-13117803 CCTGCAATCTAGAGGGCAGAAGG - Intronic
1093240904 12:16671956-16671978 CCTAAACTATTGTAGGCAGATGG + Intergenic
1096038422 12:48493011-48493033 CTGACAATGTTCAAGGGAGATGG + Intronic
1097001921 12:55884188-55884210 CCTTCAATGTTGGAGGCTGGAGG - Intergenic
1098387496 12:69934488-69934510 CCTCCACTGGTGAAGGCAAAGGG + Intronic
1100009133 12:89932961-89932983 CCTACTATGTGTAAGGCACATGG - Intergenic
1101260608 12:103025885-103025907 CTTACATGGTGGAAGGCAGAAGG - Intergenic
1103037632 12:117669112-117669134 TGTACCATGTTGTAGGCAGAAGG - Intronic
1104003711 12:124877475-124877497 CCTTCTTTCTTGAAGGCAGAGGG + Intronic
1104107715 12:125680050-125680072 GATATAATGTTGAAGGCAGAAGG - Intergenic
1104805607 12:131587489-131587511 CCTACAATGTGGCAAGCAGGGGG - Intergenic
1105448561 13:20478332-20478354 CCTACAACTTTTAAAGCAGAAGG + Intronic
1105961406 13:25344449-25344471 GCTACAATGATTAAGGCAGTGGG - Intronic
1105967493 13:25397918-25397940 CCTGAATTGTTGAAGGCAGCGGG + Intronic
1106355203 13:28975513-28975535 CCTACAGTGCTGAAGGCAGGGGG - Intronic
1106827941 13:33544511-33544533 CCTAAAATGTAGAAAGCAGTCGG + Intergenic
1107118024 13:36767918-36767940 AATACTATGTTGAAGGCACAAGG + Intergenic
1107323777 13:39217621-39217643 GCTACAATGTTTTAGTCAGATGG + Intergenic
1107769056 13:43770279-43770301 CCTACAATGGTGTAAGTAGAAGG + Intronic
1108450395 13:50556782-50556804 CCTTCAATGGTGAAGGCATGAGG - Intronic
1108574397 13:51779025-51779047 CATACAATGTGGAAAACAGATGG + Intronic
1109453171 13:62545681-62545703 CCTACAAATTTGCAGGTAGAGGG - Intergenic
1112483222 13:99796222-99796244 CCCTCAAAGTTGAAGGCTGATGG - Intronic
1114951961 14:27765867-27765889 ACTAGAAGGTGGAAGGCAGAAGG + Intergenic
1116650618 14:47587035-47587057 CCTACAATAATGAAGGCATCAGG + Intronic
1117064066 14:51991371-51991393 ACTACAAGATTGAAGACAGAGGG + Exonic
1118452554 14:65917376-65917398 CCTACAGTGCTGCTGGCAGAAGG - Intergenic
1118912750 14:70075511-70075533 CCAACAAGGCAGAAGGCAGAAGG - Intronic
1119901001 14:78259721-78259743 CCTAGAGAGTTGAAGGCAGAAGG - Intronic
1119904298 14:78287429-78287451 CCTACAATGTGGCAGGTAGTGGG - Intronic
1120298147 14:82671343-82671365 CCCAGAATGTTGATGGCTGAGGG + Intergenic
1120532156 14:85644851-85644873 CATAAAATGTTTCAGGCAGATGG + Exonic
1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG + Intergenic
1121064535 14:90950420-90950442 CCTACAATGTTGAATAAAGTGGG + Intronic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1124088131 15:26571334-26571356 CCAACAGTGTTGCAGACAGAGGG - Intronic
1125356865 15:38825619-38825641 CCTACGATGTGTAAGGCAGTAGG - Intergenic
1125733297 15:41906551-41906573 CCTGCAATGGTGAGGGCAGAGGG - Intronic
1126538315 15:49793599-49793621 CCTACAATTTTGAATGAAAATGG + Intergenic
1127780350 15:62307706-62307728 CCTACAGAGTTGAACACAGAGGG - Intergenic
1131196840 15:90362355-90362377 CCTACAATGAACAAGCCAGAGGG + Exonic
1132415350 15:101615233-101615255 CCTACCATGGGGAATGCAGAAGG + Intergenic
1139206165 16:65030971-65030993 CCTACAATGTAAAAGGCCTAAGG + Intronic
1142988806 17:3715268-3715290 CCTATGATGCTGAAGACAGAAGG + Intronic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1143145479 17:4772401-4772423 ACTACAATGGTCGAGGCAGAAGG + Intronic
1143858412 17:9869892-9869914 CCTCCACTTTTGAAGGCAGAAGG + Intronic
1144262898 17:13540448-13540470 CATACAATGTTGAAGATGGAAGG - Intronic
1150112015 17:62509808-62509830 CTCACAAAGTAGAAGGCAGAAGG - Intronic
1150486016 17:65544317-65544339 ACTGCAATATTGAAGGCAAAAGG + Intronic
1152167395 17:78718944-78718966 CCTACTAGGTGGAAGGCAGCGGG + Intronic
1152464738 17:80459480-80459502 CCAAGAATGTTCAAGCCAGAAGG + Intergenic
1154023102 18:10682550-10682572 CCCACAGTCTTGAAGGGAGAAGG - Intronic
1155215831 18:23642217-23642239 CCTGCAATGTGGCAAGCAGAAGG - Intronic
1155336587 18:24771342-24771364 GCTACCCTCTTGAAGGCAGAAGG - Intergenic
1155791207 18:29972856-29972878 CCTACAAAATTGAGGGCAGTTGG - Intergenic
1157180933 18:45497420-45497442 CATACAATCTTTCAGGCAGAGGG + Intronic
1158621247 18:59034415-59034437 CCCACAATGTTGAAGGCACGGGG + Intergenic
1158762857 18:60411108-60411130 CCTGGAATATTGAAGGGAGAAGG + Intergenic
1159949021 18:74466176-74466198 CTTACAATGTTGAAGGCACAAGG + Intergenic
1163345214 19:16736977-16736999 AGTAGAATGTTGAAGCCAGAAGG + Intronic
925027050 2:618298-618320 CCTAAAATGCTGAAAGCAAAGGG + Intergenic
928247338 2:29642060-29642082 CCTAGACTTTTGAAGACAGAAGG - Intronic
928287274 2:30003049-30003071 ACTACAATGTTGAATACAGGTGG - Intergenic
929532992 2:42763953-42763975 CCCACAGTGGTAAAGGCAGAGGG + Exonic
929883899 2:45861619-45861641 CCTACAATGTGCAAGAGAGAAGG - Intronic
930222242 2:48756320-48756342 CTTACCATGTAGAAGCCAGAAGG - Intronic
932873310 2:75425412-75425434 CCTCCACTGGTGAGGGCAGAGGG + Intergenic
934485354 2:94703427-94703449 ACTAGAAGGTGGAAGGCAGAAGG - Intergenic
934563879 2:95327864-95327886 CCTGCAAGGTGGGAGGCAGAGGG - Intronic
935153982 2:100465889-100465911 CCTGGGATGTTTAAGGCAGAGGG + Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935496100 2:103783330-103783352 CCTAGAATCCTGAAGGCAGAGGG + Intergenic
936933192 2:117811431-117811453 TCTACATTGTAGAAAGCAGATGG - Intergenic
940996920 2:160159542-160159564 CCTTCAATCTTGAAGGCAGTGGG - Intronic
942601073 2:177641710-177641732 CCTATAATGGTGAACACAGAAGG + Intronic
942910729 2:181241392-181241414 TCTACATTGTTGGAGGCAGGAGG + Intergenic
944021375 2:195109119-195109141 CCTACGATCTTGAAAACAGACGG + Intergenic
944282424 2:197913029-197913051 CTTACATTGTTGGAGTCAGAAGG - Intronic
944920212 2:204404801-204404823 CCTCCAATGCACAAGGCAGACGG - Intergenic
945642960 2:212453354-212453376 TCTCCATTTTTGAAGGCAGAAGG - Intronic
945857575 2:215086856-215086878 CCTACAATCTTGTTGGCAGTTGG - Intronic
947113992 2:226749614-226749636 ACTAAATGGTTGAAGGCAGACGG - Intronic
947215638 2:227747540-227747562 CCTACAATTTGGAAGGCTGAGGG + Intergenic
1169182755 20:3584424-3584446 CCCAGGATGTTGAAGGCAAAAGG - Intronic
1169359487 20:4936130-4936152 CTCACAATGTAGAAGGCTGATGG - Intronic
1169678609 20:8183161-8183183 TCTACAAGGATGAAGCCAGATGG - Intronic
1170920548 20:20674929-20674951 CCTAAAATGGTGAAGGGGGAGGG + Intronic
1179060741 21:37976676-37976698 CCTAAAAGGTTGAGAGCAGATGG + Intronic
1182892409 22:33829911-33829933 CCTACAAGGGTGAAGGCAGGAGG + Intronic
1183038434 22:35158084-35158106 CCTTCAATTATGAATGCAGAAGG - Intergenic
949300086 3:2573807-2573829 CCTACACTGAAGAAGGCATATGG - Intronic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
953453344 3:43021995-43022017 CCTGCAATGTTCATGGCAGGAGG - Intronic
959345446 3:105189007-105189029 CCTGAAATGTTTAAGGGAGATGG - Intergenic
960624652 3:119670072-119670094 TCCACAAAGTAGAAGGCAGAAGG + Intronic
961334506 3:126163464-126163486 ACTACAATATTGAATACAGATGG + Intronic
962883587 3:139601857-139601879 CCTACAATGTTGAAGGCAGATGG + Intronic
963713550 3:148776173-148776195 CTTACATGGTAGAAGGCAGAAGG - Intergenic
964028690 3:152110275-152110297 GCTAAAATGTTTTAGGCAGAGGG + Intergenic
965069401 3:163898888-163898910 CTTACAATGTTGAACTCAGGAGG - Intergenic
965380373 3:167980924-167980946 CCCAGATTGTGGAAGGCAGACGG - Intergenic
966086812 3:176078349-176078371 CCTACAATTTTGAAGGAGAAGGG - Intergenic
966093875 3:176174382-176174404 CTTACTATGTTCAAGGCAGTGGG - Intergenic
967306085 3:188060880-188060902 CCTAAAATGTTAAGGCCAGAAGG - Intergenic
967632435 3:191760860-191760882 CTTACAATGTAGTAGGAAGAGGG + Intergenic
969835218 4:9834936-9834958 CCTGCAATGATGAAGGCAGCCGG + Exonic
970570118 4:17371874-17371896 CCTACTATGTTCCAGGCAGAGGG - Intergenic
971388596 4:26164194-26164216 ATTACAATGTTGAAGACAGCTGG - Intronic
973953185 4:56038057-56038079 CCTACCATGGTGAGAGCAGAGGG + Intergenic
974589485 4:63925472-63925494 CCCACCATGTGGAAGGGAGAAGG - Intergenic
975181326 4:71349029-71349051 CCTACACTGTTAAAGGAAAATGG - Intronic
975241584 4:72066197-72066219 CTTACAAGGTGGAAGGCATAAGG + Intronic
976033510 4:80787705-80787727 CCTAAAATATTTAAGGCATATGG + Intronic
978534993 4:109751287-109751309 CTTACACTTTTGAAGGAAGAGGG + Intronic
980486356 4:133461998-133462020 GCTAAAATGTGGAAGGCACAGGG + Intergenic
982331361 4:154185192-154185214 CCTACATGGCAGAAGGCAGAGGG - Intergenic
982780045 4:159481205-159481227 CCTACAATCTGGGAGGAAGAAGG - Intergenic
984482398 4:180322685-180322707 TCAACAAAGTTGAATGCAGAAGG - Intergenic
984752327 4:183289809-183289831 CCAAAAATGTTGAAGGAACAAGG + Intronic
984845119 4:184102202-184102224 CCTACAATGCTGAATGCAAACGG - Intronic
984920190 4:184757196-184757218 CCTTCATTGTTGGAGTCAGAAGG + Exonic
985899939 5:2780491-2780513 CCAACAGTGTTGGAGGCAGAGGG - Intergenic
986576246 5:9215658-9215680 CTTAAAATGCTGAAGGCTGAAGG - Intronic
988115378 5:26881511-26881533 CCTACAACGATGAAGGCGGCGGG - Exonic
991408969 5:66328330-66328352 CCTCCCATGTGGAAGGCAGAAGG - Intergenic
991522319 5:67514823-67514845 CCTACTATGTTCCAGGCACAGGG + Intergenic
992678659 5:79130988-79131010 CCTTCAATGTCAAAGCCAGATGG + Exonic
993151220 5:84164843-84164865 CTTACAAGGTTGAAAGCAGAGGG + Intronic
993261780 5:85666838-85666860 CCTTCAATGTTGAACTCACAGGG - Intergenic
994619296 5:102144451-102144473 CTTTAAATGTTGAAGGCAGATGG - Intergenic
995070653 5:107918037-107918059 CCAAAAATGTGGAAGGTAGAAGG - Intronic
996390016 5:122950366-122950388 CCTATGATGTTTGAGGCAGAAGG + Intronic
997728625 5:136145452-136145474 CTTACATTCTTGATGGCAGAAGG + Intronic
998384046 5:141745922-141745944 CAAAGAATGTTGCAGGCAGAGGG - Intergenic
998956094 5:147439964-147439986 CTTTCAATATTGAATGCAGATGG - Intronic
1004774008 6:18821951-18821973 CCTTCTATATTGAATGCAGATGG + Intergenic
1004789444 6:19007873-19007895 CTTACATTGTTGAAGGGAAAAGG - Intergenic
1005290678 6:24375701-24375723 TCTACAATGTTCAAGACAGTAGG + Intergenic
1006556915 6:34874960-34874982 CCTGCAAAGATGAAAGCAGAGGG + Exonic
1006965301 6:37977605-37977627 CCTACAATGTTGAATAGAGGTGG + Intronic
1007295145 6:40815684-40815706 CCTACAATGTTGCATCCACAGGG - Intergenic
1008226019 6:48918137-48918159 CCTACATAGTTGTAGGAAGAAGG - Intergenic
1010839600 6:80633269-80633291 ACTACATTTTTGAAGGCATAAGG - Intergenic
1012367908 6:98464727-98464749 CATATAATGTTGAAAACAGAAGG - Intergenic
1014573528 6:123041302-123041324 ACTAACATTTTGAAGGCAGAAGG - Intronic
1014903198 6:126993832-126993854 GCTACAAAGTTGAAGGAAGGTGG + Intergenic
1015697500 6:135997737-135997759 CTTACAATGTTAAATGGAGAAGG + Intronic
1016622184 6:146123766-146123788 TCTAGAATGTTTGAGGCAGATGG - Intronic
1016638003 6:146316837-146316859 CCTAAAATGTTGAAGGCCCAAGG + Intronic
1016983398 6:149874934-149874956 CCCACATGGTGGAAGGCAGAAGG + Intergenic
1019591623 7:1838600-1838622 CCTGCAGTGTTGCAGGGAGATGG - Exonic
1026345077 7:69466666-69466688 CTCATAATGGTGAAGGCAGATGG - Intergenic
1027220333 7:76209994-76210016 CCTACCCTATTGCAGGCAGAGGG - Intronic
1028775502 7:94671581-94671603 CTTTCAATGTTCAAGGCAGTAGG + Intergenic
1029165883 7:98590111-98590133 CCTACTATGTGCAAGGCACAAGG - Intergenic
1031101464 7:117486087-117486109 CCTACAAAGGCTAAGGCAGAAGG - Intronic
1031493389 7:122417445-122417467 CCTACAATGTTGTTGGCTGTAGG + Intronic
1032041210 7:128563718-128563740 CTCACAAAGTAGAAGGCAGAAGG - Intergenic
1032756107 7:134892220-134892242 CCTGGAATGTTAAAGCCAGAAGG + Intronic
1032763597 7:134968265-134968287 CCTGCAGTGTTTCAGGCAGATGG - Intronic
1033631126 7:143159159-143159181 ACTACAGTGTTGGAGGCAAAAGG - Intergenic
1033668810 7:143469782-143469804 CTTACATTGTAGAAGGCAGAAGG - Intergenic
1035841538 8:2817117-2817139 CATACAATGTTCAAGGAAAATGG - Intergenic
1037184742 8:16048906-16048928 CCTAGGATGTTGAAGACAAAAGG - Intergenic
1044389443 8:91632252-91632274 ACTAAAATGTAGAATGCAGAAGG - Intergenic
1046551776 8:115727374-115727396 CCCCAAATGATGAAGGCAGAAGG + Intronic
1048714355 8:137251406-137251428 ACTAGAAAGTTAAAGGCAGAAGG + Intergenic
1052723404 9:32200364-32200386 CCTACCATGTGGAAGGAAGCTGG + Intergenic
1053558015 9:39158518-39158540 GTTACCATGTTGATGGCAGAGGG - Intronic
1053822131 9:41978804-41978826 GTTACCATGTTGATGGCAGAGGG - Intronic
1053922255 9:43007290-43007312 TCTAGAAGGTGGAAGGCAGAAGG + Intergenic
1054139099 9:61460434-61460456 GTTACCATGTTGATGGCAGAGGG + Intergenic
1054383552 9:64520963-64520985 ACTAGAAGGTGGAAGGCAGAAGG + Intergenic
1054608443 9:67208609-67208631 GTTACCATGTTGATGGCAGAGGG + Intergenic
1055475059 9:76654816-76654838 CCTACAGTGTGGTAGGAAGAAGG - Intronic
1057233011 9:93336273-93336295 CCCACCAAGTTGCAGGCAGAGGG - Intronic
1057252501 9:93515348-93515370 CCCACCAAGTTGCAGGCAGAGGG + Intronic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1058524480 9:105843458-105843480 TCTAGAATATAGAAGGCAGAAGG + Intergenic
1059062138 9:111044680-111044702 AGTACAATGTTGAATGGAGATGG - Intergenic
1061170296 9:128948600-128948622 GCTGCAATGTGGAAGACAGAAGG - Intronic
1061912673 9:133733343-133733365 GCTGAAATGGTGAAGGCAGAAGG + Intronic
1062451033 9:136615942-136615964 CCCAGATTGTTGGAGGCAGAGGG + Intergenic
1187402438 X:18973693-18973715 CCTCCATTGTTGTAGACAGAGGG - Intronic
1187857681 X:23652786-23652808 TCCACTAAGTTGAAGGCAGATGG - Intergenic
1194935239 X:99939939-99939961 TCTATAATGTTGCAGCCAGAAGG + Intergenic
1197232839 X:124024526-124024548 CCTACAATGTTGAGAGGAAAGGG - Intronic
1197341478 X:125272128-125272150 CCTCAAAAGTTGAAAGCAGAGGG - Intergenic
1199024056 X:142917150-142917172 CCGACAAGGATGAAGGCTGATGG - Intergenic
1201678126 Y:16610959-16610981 CTCACAATGTAGAAGTCAGATGG - Intergenic