ID: 962883896

View in Genome Browser
Species Human (GRCh38)
Location 3:139605209-139605231
Sequence ATGAATAAGGATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1046
Summary {0: 1, 1: 0, 2: 6, 3: 126, 4: 913}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962883896_962883901 9 Left 962883896 3:139605209-139605231 CCTTCCTCCTCATCCTTATTCAT 0: 1
1: 0
2: 6
3: 126
4: 913
Right 962883901 3:139605241-139605263 ATCTTGATATTAGAAATTATTGG 0: 1
1: 0
2: 2
3: 45
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962883896 Original CRISPR ATGAATAAGGATGAGGAGGA AGG (reversed) Intronic
900725553 1:4214191-4214213 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
900816745 1:4853205-4853227 AGGATAAAGGAGGAGGAGGAAGG - Intergenic
902165799 1:14570384-14570406 AGGAATTGGGAGGAGGAGGAGGG - Intergenic
902834587 1:19038404-19038426 ATGAATAGGGATGTGGGGGGCGG - Intergenic
902840117 1:19068987-19069009 ACAGATAAGGATGGGGAGGAAGG + Intergenic
902981325 1:20125544-20125566 AATAATGAGGATGAGGATGATGG + Intergenic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904565471 1:31425803-31425825 CTGGATGAGGATGAAGAGGAAGG - Exonic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
906733150 1:48100498-48100520 ATGAATAAGGATTAGAAGTGAGG + Intergenic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
908857947 1:68450297-68450319 ATGAATGAGGGTGAGAATGAAGG - Intergenic
909160248 1:72138117-72138139 AGGAATAAGGAGGAGTAGAAAGG + Intronic
909349811 1:74638027-74638049 AGGAAGGAGGATGAGAAGGATGG + Intronic
909583828 1:77266903-77266925 ATGAAGAAGGCAGAGAAGGATGG + Intergenic
909975926 1:82046154-82046176 GTGAAAAAGGAAGAGGAGGCAGG - Intergenic
909996152 1:82282116-82282138 AAAAAAAAGGGTGAGGAGGAGGG + Intergenic
910021792 1:82599673-82599695 ATGAATGAGGACAAGAAGGAAGG - Intergenic
910269871 1:85382560-85382582 ATGAATATGGTTGATGAAGATGG + Intronic
911035031 1:93533459-93533481 ATGACCAATGAGGAGGAGGAAGG + Intronic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911768839 1:101713310-101713332 ATGAATTAGAAGCAGGAGGAAGG - Intergenic
911882546 1:103259628-103259650 ATGAATAAGTAGGAGGGGGCAGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912528042 1:110299446-110299468 AGGAACTAGGATGGGGAGGAGGG - Intergenic
912731456 1:112110216-112110238 ATGATTAAGCTTGGGGAGGAAGG - Intergenic
913079915 1:115374063-115374085 AAGAATTAGAATGAGGAGGTGGG - Intergenic
913098713 1:115543447-115543469 AGGAGTAAGGATGAGGAGAAAGG + Intergenic
913136619 1:115896671-115896693 AGGAGTAAGAATGAGGAAGATGG - Intergenic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
913332361 1:117678096-117678118 AGGAAGAAAGAGGAGGAGGAAGG + Intergenic
913360160 1:117971620-117971642 ATGAATAATGATGACTAGGAGGG + Intronic
913412024 1:118562607-118562629 ATGAATAAGGGGGAGGGGGAAGG + Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914505732 1:148287597-148287619 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
914519645 1:148404094-148404116 AGAAAAAAGGAGGAGGAGGAAGG - Intergenic
914696827 1:150090660-150090682 AGGAATAAGGCTGCAGAGGATGG - Intronic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
916149335 1:161771206-161771228 AGGAGAAAGGAGGAGGAGGAGGG - Intronic
916528630 1:165634833-165634855 ATGATCAAGAATGAGAAGGAAGG - Intronic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917369765 1:174279810-174279832 AAAAAGAAGGATGGGGAGGAAGG - Intronic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918337767 1:183537468-183537490 AATAGTAAGAATGAGGAGGAAGG - Intronic
918565719 1:185929148-185929170 ATGAATATGGAAGAGGAAAAGGG - Intronic
918650530 1:186956885-186956907 ATTAATAATATTGAGGAGGACGG + Intronic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919543521 1:198881305-198881327 ATAAATAAGTGTGAGGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
920365098 1:205444125-205444147 ATGGAAAAGGAGGGGGAGGATGG - Intronic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
920662797 1:207932098-207932120 AAGAAAAAGGATGAAGTGGAGGG - Intergenic
920808697 1:209260785-209260807 ATCAAAAAAGATGAGAAGGAAGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921818371 1:219589387-219589409 ATGAAAAAGGGAGAGGAGGAGGG + Intergenic
921887521 1:220321621-220321643 ATGGAGGAGGAAGAGGAGGAAGG + Intergenic
922698562 1:227744585-227744607 ACACAGAAGGATGAGGAGGAAGG - Intronic
922722740 1:227906839-227906861 AGGAAGGAGGATGAGGAAGAGGG - Intergenic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
922867874 1:228875943-228875965 AGGAATAATAAGGAGGAGGAGGG - Intergenic
923154158 1:231261832-231261854 ATTAAAAGGGATGAGGAGGAAGG - Intronic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
924481176 1:244435656-244435678 ATGGAGGAGGAAGAGGAGGATGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
924911997 1:248523048-248523070 CTGCACAAGGATGAGAAGGATGG - Intergenic
1062890194 10:1053621-1053643 ATGATTAAGCATGGTGAGGAAGG - Intronic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1063159507 10:3408952-3408974 AGGAAGAAAGAGGAGGAGGAGGG + Intergenic
1063277426 10:4585641-4585663 ATGACTATGGTTGAGGAGCATGG + Intergenic
1063419239 10:5898080-5898102 GTCAAGAAGGATGAGGAGCAGGG - Intronic
1063487449 10:6433247-6433269 ATCCATCAGGATGAGGGGGAAGG - Intronic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1064276289 10:13908289-13908311 AGGAAAAAGGATGAGAAGCATGG - Intronic
1064635240 10:17358589-17358611 AGGAAGAAGGAGGAGAAGGAGGG + Intronic
1064741248 10:18437277-18437299 ATGGATAAGGATGTGGAGAGAGG + Intronic
1065327609 10:24563064-24563086 ATGGAGAAGGGTGGGGAGGAGGG - Intergenic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1065747418 10:28855015-28855037 AGGTAGAAGGATAAGGAGGAAGG - Intronic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066226882 10:33392496-33392518 GAGAATGAGGATGAGGAAGAGGG - Intergenic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1067557813 10:47284874-47284896 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067557819 10:47284894-47284916 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067670743 10:48318787-48318809 ATGAATAAGGAAGAATTGGAGGG + Intronic
1068666401 10:59680143-59680165 ATGAATAAAGCTGGGTAGGAAGG - Intronic
1069124385 10:64611340-64611362 AAGAATAAGCATGAGAGGGATGG + Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070578431 10:77698489-77698511 ATGATGAAGGAGGAGAAGGAGGG + Intergenic
1070741667 10:78907463-78907485 AAGAAAGAGGAAGAGGAGGAGGG - Intergenic
1070976409 10:80609304-80609326 AGGTAAAAGGAGGAGGAGGAAGG - Intronic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071431659 10:85611617-85611639 ACCAAGAAGGATGAGAAGGATGG - Intronic
1071952273 10:90717372-90717394 ATGAAGAAGGAAAAGGAGCATGG + Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072348553 10:94534274-94534296 ATGAGTAAAGAAGATGAGGATGG - Exonic
1072423775 10:95311662-95311684 ATGATTAAGGATGGAAAGGAGGG + Intergenic
1072785607 10:98278300-98278322 AAGTATAAAGATGAGAAGGAAGG + Intergenic
1073723673 10:106204703-106204725 AATAATAAGGGTGAGAAGGATGG + Intergenic
1074126783 10:110534950-110534972 ATGATGAAGAAGGAGGAGGAGGG + Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1075070298 10:119315872-119315894 ATGAATTTGGAGGGGGAGGAAGG - Intronic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075083781 10:119400744-119400766 AGGAATAAGGGGGATGAGGAAGG + Intronic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1076896088 10:133312973-133312995 AGGAACAAGGATGGGGAGGATGG - Exonic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077316977 11:1923701-1923723 GTGACTAATGATGAGGAAGATGG - Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078502600 11:11896387-11896409 AGGAATTGGGAGGAGGAGGACGG + Intronic
1079051886 11:17168029-17168051 AGGAATAAGGAAGAGAAAGAAGG + Intronic
1079243006 11:18733803-18733825 AGGACTCAGGATGAGGAGGAGGG + Intronic
1079386858 11:19988164-19988186 AAAGAAAAGGATGAGGAGGATGG - Intronic
1079410280 11:20181097-20181119 AGGAAGAGGGAGGAGGAGGAAGG - Intergenic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079445572 11:20553706-20553728 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1080119275 11:28657710-28657732 ATGGAAAAAGATGAAGAGGAGGG + Intergenic
1080423339 11:32132949-32132971 ATGAATAACAATGAGTAGAATGG - Intergenic
1080506439 11:32918660-32918682 ATGACTCAGGCTGAGGATGAGGG + Intronic
1080785908 11:35474852-35474874 ATGAATAGGGAAAAGGAAGAAGG + Intronic
1080825317 11:35843813-35843835 ATAAATAAAGATGAAAAGGAGGG + Intergenic
1081176666 11:39935531-39935553 ATGATTAAGGCTCACGAGGAAGG + Intergenic
1081514962 11:43819626-43819648 ATGAAGAATGAAGAAGAGGAAGG - Intronic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082922157 11:58507464-58507486 AGAAATAAGGATGACCAGGAGGG + Exonic
1082954608 11:58856501-58856523 ATGATTAAGCATAGGGAGGAAGG - Intronic
1084157618 11:67322968-67322990 ATGAACAGGGCTGAGGTGGAGGG - Intronic
1084347667 11:68566300-68566322 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
1084449604 11:69228223-69228245 TGGAATAATGATGATGAGGATGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1085140924 11:74140812-74140834 ATGAAGAGGGGTGAGGAGGGAGG + Intronic
1085458570 11:76679525-76679547 ATGAATAAGGAAGCTGAGGCTGG + Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086224359 11:84489780-84489802 TTGAATATGGATGATTAGGAAGG - Intronic
1086253278 11:84843489-84843511 AGGAATAATGATGATGATGATGG - Intronic
1086306289 11:85484245-85484267 ATGCCTAGGGAGGAGGAGGAGGG - Intronic
1086474258 11:87153575-87153597 ATGAATAACAATGAGGTAGAAGG - Intronic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086740235 11:90358717-90358739 AAGAAAAAGTATGAGCAGGAGGG - Intergenic
1086998917 11:93392984-93393006 AGAAAGAAGGAGGAGGAGGAGGG - Intronic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087231200 11:95667452-95667474 ATGAAGAAGGATCAGGACCATGG - Intergenic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1089028636 11:115298801-115298823 ATATAGAAGGATGAGGAGAATGG + Intronic
1089037368 11:115408641-115408663 ATGAATAAGTACTAGGAGGAGGG - Intronic
1089067297 11:115671428-115671450 ATGAAGAAAAATGAGGAAGAGGG - Intergenic
1089643489 11:119863204-119863226 GAGAAGCAGGATGAGGAGGATGG + Intergenic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1089940209 11:122408621-122408643 ATGAATAAAGATGTGAAGGAGGG - Intergenic
1090961548 11:131561781-131561803 AAGAAGAAGGATGATGATGAAGG - Intronic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091833561 12:3568249-3568271 ATGGAATAGGCTGAGGAGGAGGG + Intronic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091936690 12:4440451-4440473 ATGGAGAAGGATGGGGTGGAAGG + Intronic
1092283409 12:7114442-7114464 AAGAACAAGGATGAGGACAACGG + Intergenic
1092310686 12:7348411-7348433 ATTAATAAGGAAGAGGAGAATGG + Intronic
1092481241 12:8860985-8861007 AGGAATACGCATGAGAAGGAGGG - Intronic
1092769493 12:11883948-11883970 ATGGATAAAGATGAGAAGGCTGG - Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093125376 12:15322491-15322513 ATGACTAAGGATGGAGAGGGTGG - Exonic
1093508370 12:19896595-19896617 AAGAAGAAAGAAGAGGAGGAAGG - Intergenic
1093548933 12:20383751-20383773 ATGGAAAAAGGTGAGGAGGAGGG + Intronic
1094070298 12:26405159-26405181 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1094675501 12:32616138-32616160 ATTAATGAGGAAGAGGAGAAAGG - Intronic
1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG + Intronic
1095489117 12:42714683-42714705 ATGAATAAGAAAGACAAGGACGG + Intergenic
1095907306 12:47391508-47391530 AGGAAGAAGGATGAGAAGCAGGG + Intergenic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096076714 12:48810538-48810560 CTGAATAAGGTTGAGGAAGTGGG - Intergenic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096698351 12:53365542-53365564 TTGACTAAGGCTGAGGAGGGAGG - Intergenic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1097008804 12:55938110-55938132 AGGAATAAGGGAAAGGAGGATGG - Intronic
1097185925 12:57196329-57196351 ATGAATAAGGCAGTGGAGAAAGG - Intronic
1097836009 12:64273408-64273430 ATGCATAAGTTTGAGGAGGTGGG + Intronic
1098011717 12:66060457-66060479 AAAGATAAGGAAGAGGAGGAGGG - Intergenic
1098032516 12:66269022-66269044 ATGAAGAAGGTAGAGGGGGAAGG - Intergenic
1098065714 12:66614092-66614114 CTGAAAAAGGAAGAGGAGAAAGG - Intronic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098250925 12:68568947-68568969 ATCTAGAAGGGTGAGGAGGATGG - Intergenic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098549711 12:71749830-71749852 ATGAATAAGAATCACAAGGAGGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098793287 12:74855854-74855876 ATTAATAATGATGAGGAGCATGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099660577 12:85554244-85554266 ATGAAAAATGATGACGATGATGG + Intergenic
1100330955 12:93581800-93581822 ATGAGAAAGGATGGAGAGGATGG + Intronic
1100410232 12:94310383-94310405 ATGAATGGGGGTGAGTAGGAGGG - Intronic
1101469806 12:104986057-104986079 ATAAAAAAGGATAAAGAGGAGGG + Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102570347 12:113823535-113823557 ATGAAGAAAGATAAGGAGTAGGG + Intronic
1102588740 12:113941706-113941728 CTCAAGATGGATGAGGAGGATGG - Intronic
1102792313 12:115657774-115657796 AAGAAGGAGGATGAGGAGGAGGG - Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102970484 12:117162231-117162253 ATGGATCATGATGAGGACGAAGG + Intronic
1103257164 12:119551621-119551643 ATGAATGAGAGTCAGGAGGAAGG - Intergenic
1103263148 12:119606386-119606408 AGGAATGAAGATGATGAGGATGG + Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104710511 12:130982534-130982556 AAGAAGAAGGAAGAAGAGGAGGG - Intronic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105277551 13:18944535-18944557 AGGGGTAAGGATGAGGAGGCTGG - Intergenic
1105770744 13:23609483-23609505 ATTAATACGAGTGAGGAGGATGG - Intronic
1107194578 13:37634291-37634313 ATTAATGAAGATGAGGAGTAGGG - Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1107758489 13:43651246-43651268 AAGAAAAAGGAAGAGGGGGAGGG + Intronic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108410229 13:50138426-50138448 AAGAAGATGGATGAGGAGGAGGG + Intronic
1108887975 13:55212993-55213015 TTGAGTAAGGATGTGAAGGATGG + Intergenic
1109733684 13:66452449-66452471 ATAAATGGGGATGAGGAAGAGGG - Intronic
1109780107 13:67099276-67099298 ATGTAAAAGGATGTGGAGAATGG - Intronic
1110169747 13:72486332-72486354 ATGATTAAGAATGAGCAGGTGGG - Intergenic
1110785948 13:79526174-79526196 TTGGATAAGGATGAGGGAGAAGG + Intronic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112744840 13:102514894-102514916 AAGAAGAAGGAAGAGGAGCAAGG + Intergenic
1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG + Intronic
1114913188 14:27226755-27226777 ATGAATAAGGATAGTGAGCATGG - Intergenic
1115544437 14:34453006-34453028 AATCATAAGGAGGAGGAGGAGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116626155 14:47266481-47266503 ATGATTGAGCATGAGGAGGCAGG - Intronic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1116802140 14:49454142-49454164 GTGAAGATGGGTGAGGAGGAAGG - Intergenic
1117058140 14:51933843-51933865 GAGAATGAGGATGAGGAGAAAGG + Intronic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117417567 14:55511579-55511601 ATGAAAAAGGAAGAGGTTGAAGG - Intergenic
1118009375 14:61593892-61593914 ATTAAGAGGGAAGAGGAGGAGGG + Intronic
1118140284 14:63072850-63072872 GAGAAGGAGGATGAGGAGGAGGG - Intronic
1118209974 14:63756784-63756806 ATGAAAAATAATGAGGAGGCTGG + Intergenic
1118848015 14:69562738-69562760 ATGAACAAGGAGGTAGAGGAGGG + Intergenic
1118849609 14:69573698-69573720 GTGACTATGGATGAGGAGGGGGG - Intronic
1118981902 14:70723941-70723963 ATGACAGAGGATGAGGAGGGTGG + Intronic
1119067410 14:71542665-71542687 AGGAAGGAGGAGGAGGAGGAGGG - Intronic
1119177558 14:72580367-72580389 ATGAATATGGATGCCAAGGATGG - Intergenic
1119851048 14:77866993-77867015 ATGAGTAAATAAGAGGAGGATGG - Intronic
1120147980 14:81000624-81000646 ATGAATCAGGCTGACGTGGAGGG - Intronic
1120513380 14:85442208-85442230 AGGAATAAGCAAGAGCAGGAAGG + Intergenic
1120864245 14:89282154-89282176 ATGATTGAGGAGGAGTAGGAGGG + Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121735723 14:96216730-96216752 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1122092451 14:99349331-99349353 ATGAAAGAGGAAGAGGCGGAAGG + Intergenic
1122431495 14:101650938-101650960 ATGAAAAAGAATGAAGAGTATGG + Intergenic
1123800313 15:23811953-23811975 ATGAAGAAGGAGGAGGATGGTGG + Intergenic
1124188927 15:27554543-27554565 ATGAAGAAGGCTTAGGAGAAAGG + Intergenic
1124416338 15:29475652-29475674 AGAAATGAGGAGGAGGAGGAAGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125616276 15:41016481-41016503 CTGAGTAAGGATGTGGAGCAGGG - Intronic
1125762912 15:42109946-42109968 AGAAAAAAGGAGGAGGAGGAGGG - Intergenic
1126228222 15:46296078-46296100 AATAATAAGGAAGAGGGGGAAGG + Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126881502 15:53103629-53103651 ATGAATGAGGAGGATGATGAAGG + Intergenic
1126902353 15:53327280-53327302 ATTAATAAAAATGAAGAGGATGG + Intergenic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1126970177 15:54101882-54101904 AAGTATAAGAATGGGGAGGATGG - Intronic
1127062290 15:55199106-55199128 ATGAATAAGAAGGACAAGGAAGG - Intergenic
1127503176 15:59573577-59573599 ATGAACAAGGAAGAGGAAGAGGG + Intergenic
1128095670 15:64952813-64952835 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1128147284 15:65338785-65338807 ATGAAGACAGATGAGGAGGCAGG - Intronic
1128207797 15:65868668-65868690 ATGAATCTTGATGAGGAGGGTGG + Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129207614 15:74046340-74046362 ATGAGTAGGGATGGGAAGGAGGG - Exonic
1129907969 15:79203036-79203058 AGGAATAAGGATCAGGAGAGAGG + Intergenic
1130924674 15:88375960-88375982 AGGAATGAGGAAGAGAAGGAAGG - Intergenic
1130959815 15:88652360-88652382 ATGGAGATGGGTGAGGAGGAGGG - Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131284727 15:91047849-91047871 ATGAGGAAGGAGGAGGAGTAGGG - Intergenic
1131540647 15:93272325-93272347 ATGAATCAAGACCAGGAGGAGGG + Intergenic
1131901065 15:97088523-97088545 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901083 15:97088587-97088609 AGGAAAGAGGAGGAGGAGGAAGG - Intergenic
1131901094 15:97088626-97088648 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1131901098 15:97088639-97088661 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901103 15:97088655-97088677 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131910460 15:97194222-97194244 ATGAATAAGAATAATGATGAGGG + Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132295592 15:100731998-100732020 ATGAACAAGGATGAGGAACATGG + Intergenic
1132845981 16:2001096-2001118 AGGAGTGAGGATCAGGAGGAAGG - Exonic
1133283714 16:4680997-4681019 ATCAACAAGGCTGAGGAAGAAGG - Intronic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133535053 16:6693725-6693747 GTGGATGAGGATGAGGATGATGG - Intronic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1134904435 16:17968053-17968075 ATGAATAAGGAAGTTAAGGATGG + Intergenic
1135151685 16:20012475-20012497 ATGCATAAGTATGAAAAGGAGGG - Intergenic
1135432967 16:22402250-22402272 AAGAATAAAAATGAGGGGGATGG - Intronic
1135469512 16:22717008-22717030 ATTAAGGAGGTTGAGGAGGAAGG + Intergenic
1135508315 16:23058760-23058782 AACAATAGTGATGAGGAGGAGGG - Intergenic
1135662026 16:24305201-24305223 ATGAATGGGGATGAGGAATATGG + Intronic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1135906979 16:26521080-26521102 ATATATAAGGATGAAGAGCATGG - Intergenic
1135942428 16:26834220-26834242 AAGAAGAAGGAAGAGGAGGGAGG + Intergenic
1136539100 16:30918720-30918742 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137703762 16:50519237-50519259 ATAAATAAGGCTGTGGGGGAGGG + Intergenic
1137950154 16:52775965-52775987 ATGAATGAGGATGCCGAGGCTGG - Intergenic
1138153944 16:54685793-54685815 AGGAAGAAGGAGGAGGAGAAAGG - Intergenic
1138153952 16:54685826-54685848 AGGAAGAAGGAAGAGGAGGAGGG - Intergenic
1138257335 16:55577734-55577756 CTGAATATGGTTTAGGAGGAGGG - Intronic
1139332332 16:66203107-66203129 ATGATTGAGGATGAAGAGTAAGG - Intergenic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1139906991 16:70372934-70372956 ATGAATAAGGATGGATAGGCCGG + Exonic
1139946334 16:70644925-70644947 AGGAAGGAGGAAGAGGAGGAAGG + Intronic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141157447 16:81607082-81607104 TTGAAGAATGTTGAGGAGGAGGG + Intronic
1141749030 16:85946014-85946036 GTGCATAAGGATGGGGAGGATGG + Intergenic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141775746 16:86121705-86121727 AGGGACAAGGATGAGGAGGAAGG - Intergenic
1141845116 16:86603371-86603393 AGGAAGAAGGAGGAGGGGGAAGG - Intergenic
1203141786 16_KI270728v1_random:1771705-1771727 ATGATGGAGGAGGAGGAGGAGGG - Intergenic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1143091260 17:4450243-4450265 AGGAGGAAGGAGGAGGAGGAGGG - Intronic
1143200521 17:5110186-5110208 ATGAAAAAAGAAGAGGAGGACGG - Intronic
1143794699 17:9327250-9327272 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1144287240 17:13788610-13788632 GTTAACAAGGGTGAGGAGGAAGG - Intergenic
1144746792 17:17621409-17621431 AAGAAGAAGGAAGAAGAGGAAGG + Intergenic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144996088 17:19270006-19270028 AAGAATAGGGATTAAGAGGATGG + Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1146158388 17:30544010-30544032 ATGACTAAGGATAGTGAGGAAGG + Intergenic
1146424608 17:32724721-32724743 AGGAATAAGGATGAAGTAGAAGG + Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1147424458 17:40339376-40339398 AGGGATAAGGCTGAGCAGGATGG + Intronic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147917532 17:43897710-43897732 AAGAATGAGGAAGAGGGGGAGGG - Intronic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148459880 17:47833370-47833392 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1148514108 17:48199988-48200010 AAGAATTAGATTGAGGAGGAAGG + Intronic
1148596856 17:48863435-48863457 AACACCAAGGATGAGGAGGAAGG - Exonic
1148678128 17:49456928-49456950 AAGGAGAAGGATGAAGAGGAAGG - Intronic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149441415 17:56677787-56677809 ATTGATCAGGTTGAGGAGGAGGG - Intergenic
1149544054 17:57489919-57489941 AGGAATTAGGGTGAGCAGGAGGG + Intronic
1149572844 17:57685880-57685902 AGCAATCAGGATGAGGAGCATGG - Intergenic
1150090655 17:62322307-62322329 ATTAAAAAGTTTGAGGAGGAGGG + Intergenic
1150102335 17:62434495-62434517 ATGAAAATGGGAGAGGAGGAAGG - Intronic
1150125995 17:62635388-62635410 AAGTGTAAGGATGAAGAGGAAGG - Intronic
1150526685 17:65931153-65931175 ATTCTTAAGGATGAGGAGGAGGG + Intronic
1150890545 17:69144248-69144270 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1151122745 17:71810597-71810619 ATCAAAAAGGATAAGGAGGCTGG + Intergenic
1151158775 17:72147057-72147079 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1153014827 18:574070-574092 ATGGAAAAGTGTGAGGAGGAAGG - Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153444753 18:5158513-5158535 ATGCAAAGGGAAGAGGAGGAGGG - Intronic
1153725649 18:7951996-7952018 ATGAATAAAGATGAGAGTGATGG - Intronic
1154031223 18:10755980-10756002 AAGATGGAGGATGAGGAGGAGGG + Intronic
1154031258 18:10756118-10756140 AAGATGGAGGATGAGGAGGAGGG + Intronic
1154031305 18:10756382-10756404 AGGATGAAAGATGAGGAGGACGG + Intronic
1154031321 18:10756460-10756482 AGCTATGAGGATGAGGAGGAGGG + Intronic
1154031340 18:10756582-10756604 AGGATGAAAGATGAGGAGGAGGG + Intronic
1154031359 18:10756657-10756679 AGCTATGAGGATGAGGAGGAGGG + Intronic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1156000438 18:32378749-32378771 ATGAGTCAGGAAGAGAAGGATGG - Intronic
1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG + Intronic
1156515720 18:37678476-37678498 GTGAACAATGATGAGGAGAAAGG + Intergenic
1156789816 18:40957369-40957391 CTGAATAAAGATGATGGGGAAGG - Intergenic
1157030493 18:43900972-43900994 AAGGCTAAGGAAGAGGAGGAAGG - Intergenic
1157165826 18:45357595-45357617 AAGAAGAAGGAAGGGGAGGAAGG + Intronic
1157956201 18:52100243-52100265 ATGAAGAAAGATGGGAAGGAAGG + Intergenic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159446844 18:68551267-68551289 AAGAAAGAGGAAGAGGAGGAAGG + Intergenic
1159589177 18:70313602-70313624 ATGAATGATGATGAGTAGGTGGG - Intronic
1159657770 18:71053012-71053034 ATGAAATAGGAGGAGGACGAAGG - Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160237694 18:77099017-77099039 GTCGATAAAGATGAGGAGGAGGG - Intronic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160347870 18:78149716-78149738 ATGAATAAGCTTGAGGAAGGAGG - Intergenic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160965298 19:1744688-1744710 AGGGAAAAGGATGAGGAAGAAGG - Intergenic
1160965689 19:1746077-1746099 ATGGGGAAGGATGGGGAGGAGGG + Intergenic
1160965720 19:1746158-1746180 ATGGGGAAGGATGGGGAGGAGGG + Intergenic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161800575 19:6415101-6415123 AGGAGAAAGGAGGAGGAGGAGGG + Intronic
1161801626 19:6419470-6419492 AGGGAAAAGGATGAGGTGGAGGG + Intronic
1161933701 19:7357848-7357870 ATGAAAAAGCATGAGCAGAATGG - Intronic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1162339212 19:10081755-10081777 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1162922585 19:13912376-13912398 CCGGATGAGGATGAGGAGGAGGG + Exonic
1162927098 19:13936170-13936192 TTGAGTAGGGATGGGGAGGAGGG - Intronic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163113038 19:15172995-15173017 AAGAAGAAGGAAGAGGGGGAGGG - Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163779766 19:19240107-19240129 GGGAAGAAGGATGGGGAGGAGGG - Intronic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164256833 19:23534505-23534527 CACAATAATGATGAGGAGGAAGG + Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164591913 19:29512082-29512104 GAGAGCAAGGATGAGGAGGAAGG + Intergenic
1164591989 19:29512351-29512373 GAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164592072 19:29512663-29512685 AGGAAGGGGGATGAGGAGGAAGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164592221 19:29513223-29513245 AGAGATAGGGATGAGGAGGAAGG + Intergenic
1164592497 19:29514194-29514216 AGGAGGAGGGATGAGGAGGAAGG + Intergenic
1164592691 19:29514807-29514829 GAGAGTGAGGATGAGGAGGAAGG + Intergenic
1164886194 19:31780543-31780565 ATGAACGGGGAAGAGGAGGAGGG + Intergenic
1164962664 19:32448292-32448314 ATGAATGGTGATGAGGAGCATGG + Intronic
1165416035 19:35694098-35694120 AGGAGGAAGGAAGAGGAGGAGGG - Intergenic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165690920 19:37862544-37862566 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166241690 19:41499119-41499141 AAGAATGAGGATGAAGAGGAGGG + Intergenic
1166285009 19:41820226-41820248 TTGAATAAGGATGATGAGAGTGG + Intergenic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1166460344 19:42982651-42982673 ATTAATGAGGATGAGGAGCTGGG + Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
925399648 2:3563214-3563236 ATGACTTAGGTTTAGGAGGACGG - Intergenic
925402566 2:3586028-3586050 AGGAAAAAGGAGGAGGGGGAAGG + Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925572027 2:5322672-5322694 ATGAATGAGGTCGAGGGGGATGG + Intergenic
925702126 2:6649227-6649249 ATGAAGAATGAGGAGGAAGAAGG - Intergenic
925943260 2:8839341-8839363 AAGAATAGAGATGAGAAGGAGGG + Intergenic
926137436 2:10346778-10346800 ATGGAGAAGGAAGGGGAGGAAGG - Intronic
926266838 2:11330873-11330895 AGGAAGAGGAATGAGGAGGAGGG + Intronic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926918515 2:17916352-17916374 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
927038389 2:19204028-19204050 ATGAATAAAGAAGAGGTGGAGGG - Intergenic
927710812 2:25324746-25324768 ATGGATAAGGAGGAGGGAGAGGG + Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929283741 2:40112668-40112690 AAAAATAAGGATGGGAAGGATGG + Intronic
929651673 2:43686151-43686173 AGGAAGAAGGAAGAGGAAGAAGG - Intronic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
932201257 2:69830094-69830116 ACGGACGAGGATGAGGAGGAGGG + Exonic
932208156 2:69902268-69902290 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933899296 2:86837690-86837712 ATGAGTAAGGATGAAAGGGAGGG + Intronic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934513046 2:94963454-94963476 ATAAAAAAGGGTGAGGAGGACGG + Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934847762 2:97673261-97673283 CTGAAGAAGGATGTGGAGCAAGG - Intergenic
934932351 2:98436823-98436845 AAGAATAAGGATCAGGACAAAGG - Intergenic
934979893 2:98831098-98831120 GGGAGAAAGGATGAGGAGGATGG - Intronic
935013406 2:99156582-99156604 ATGAATAAAGGTGATAAGGAGGG - Intronic
935531665 2:104240362-104240384 AGGGAGGAGGATGAGGAGGAGGG + Intergenic
935531674 2:104240388-104240410 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
935668454 2:105534970-105534992 CTGATTATGGATGAGGTGGAGGG - Intergenic
935781262 2:106511538-106511560 ATGAGTAAGGATGAAAGGGAGGG - Intergenic
935801765 2:106704587-106704609 AGGAAAGAGGATCAGGAGGAAGG - Intergenic
936061950 2:109300650-109300672 ATGGAGAAGGAAGAGGAAGATGG - Intronic
936265462 2:111001884-111001906 ATCATTAAGGATGATTAGGATGG + Intronic
936601101 2:113895443-113895465 ATGAACAAGAATTAGGAGTATGG + Intronic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938863178 2:135391423-135391445 AGGTTTAAGGATGAGGAGGGTGG - Intronic
938928617 2:136066635-136066657 ATGGATGAGGGTGAGGTGGATGG + Intergenic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939599066 2:144165864-144165886 ATGAATAAGGATGACGTTGAAGG - Intronic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940038992 2:149339752-149339774 GAGAATAAGGATGAGCAGGGGGG - Intronic
940043235 2:149382248-149382270 ATAAATAAGGTTGAGGAATATGG + Intronic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940790525 2:158026050-158026072 ATGAAGAAGGCTGGAGAGGAAGG - Intronic
941244266 2:163077819-163077841 ATGAATAAACATGAATAGGAGGG - Intergenic
942147067 2:173037444-173037466 AGGAGTAAGGACTAGGAGGAGGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942392890 2:175514499-175514521 ATGAATAAGGCTGGGGCTGAGGG + Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942544599 2:177050086-177050108 ATTAATAAGGATGATGATGATGG + Intergenic
942985402 2:182134740-182134762 ATGATGAAGGAGGAGGAGAAAGG + Intergenic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
943587106 2:189754140-189754162 ATGAAAAAGGAAAAAGAGGAAGG - Exonic
943723341 2:191228246-191228268 ATGATAAAGGGTGGGGAGGAGGG - Intergenic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
944200476 2:197101972-197101994 GTGTATGAGGATGAAGAGGAAGG - Intronic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
944213883 2:197234603-197234625 ATTAAAAAGAATGAGGTGGATGG - Intronic
944395750 2:199264071-199264093 AGGAAGAAGGAACAGGAGGAAGG + Intergenic
944541856 2:200761611-200761633 AAGAATAAGGATGAAGAGGGTGG + Intergenic
944945002 2:204673692-204673714 ATACAGTAGGATGAGGAGGATGG - Intronic
945018215 2:205542479-205542501 ATGAATGAAGTTGAGGAGAAAGG - Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945513900 2:210737996-210738018 ATGAATAAGGAAGAGAAGAGAGG + Intergenic
945703614 2:213201645-213201667 ATAAAGAAGGAGGAGGAGGGGGG - Intergenic
945772208 2:214058198-214058220 ATGATTAAGCTGGAGGAGGAAGG - Intronic
946341959 2:219075641-219075663 ATGCAGAAGGATGAGGCGGGAGG + Exonic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946758873 2:222973451-222973473 AGGTAAAAGGCTGAGGAGGAGGG + Intergenic
946888180 2:224245897-224245919 GAGAATGAGGATGAGGATGAGGG - Intergenic
948080978 2:235204932-235204954 GTGAATTGGGATGAGGAAGAAGG - Intergenic
948227021 2:236319109-236319131 ATGAAGAAGGAGGAGGGGCATGG - Intergenic
948584156 2:239008292-239008314 ATGAAGGAGGATGGAGAGGAAGG - Intergenic
948883588 2:240872315-240872337 GTGAACATGGAGGAGGAGGAGGG + Intronic
948939284 2:241188031-241188053 GAGAATGAGGACGAGGAGGAGGG + Intergenic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1169472050 20:5894938-5894960 ATGAATAAGGAAAAAGAGGTGGG - Intergenic
1169765571 20:9144655-9144677 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170341691 20:15335881-15335903 ATGAAGAATGGTGAGGAGAAGGG - Intronic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1171074686 20:22110611-22110633 AGGAAAGAGGAAGAGGAGGAGGG - Intergenic
1171074695 20:22110648-22110670 AGGAAAGAGGAAGAGGAGGAGGG - Intergenic
1171850833 20:30306845-30306867 ATGAATGGGGAGGAAGAGGATGG - Intergenic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172044493 20:32070883-32070905 ACGAAGAAAGAGGAGGAGGAGGG + Intronic
1172214425 20:33225069-33225091 ATGAGAGAGGAAGAGGAGGAAGG - Intronic
1172811337 20:37650257-37650279 ATGAAAGAGGAAGAGGAGGAGGG - Intergenic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1172970585 20:38870520-38870542 ATGCAGAAGGATGGGGAGGCTGG + Intronic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173103905 20:40113335-40113357 ATAAGAAAGGAAGAGGAGGAAGG - Intergenic
1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG + Intergenic
1173630434 20:44509979-44510001 CTGAATGAGGATGAAGAGGGCGG + Exonic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1174723880 20:52841045-52841067 AAGAATAAGGAAGAGGAGAGGGG - Intergenic
1175185481 20:57177202-57177224 AAGAAGAGGGTTGAGGAGGAAGG + Intronic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1178150426 21:29788219-29788241 ATGAAGCAGGATGAGGAGCTTGG + Intronic
1178213149 21:30560665-30560687 AAGAATGACGAGGAGGAGGAGGG + Intronic
1178349881 21:31865018-31865040 AAGAAGAAGGAGGAGGAGAAGGG - Intergenic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179081846 21:38178669-38178691 AAGAAGAAGGAAGAAGAGGAAGG + Intronic
1180933059 22:19606312-19606334 AGAAGTAAGGATGAGGATGATGG + Intergenic
1181260514 22:21593853-21593875 ATGTTTAAGAGTGAGGAGGAAGG - Intronic
1181393558 22:22601534-22601556 AAGAATAAGGATGAAGATTAGGG + Intergenic
1181508458 22:23377637-23377659 ATGAAGAAGGAAGAGAAAGAAGG + Intergenic
1181741234 22:24923481-24923503 ATGGAGAAGGAAGAGGAGAAAGG - Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1181980255 22:26761077-26761099 ATGAAGGAGGAAGTGGAGGAAGG + Intergenic
1182129974 22:27843707-27843729 AGGATGAAGGATGAAGAGGAGGG + Intergenic
1182259064 22:29059810-29059832 AAAAATAAGGGTGAGAAGGAAGG - Intronic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1184449772 22:44576007-44576029 AGGAAGGAGGAAGAGGAGGAGGG + Intergenic
1184639824 22:45864649-45864671 ATGAATGGGGATGAGGAAGCAGG - Intergenic
1184672550 22:46023020-46023042 ATGAAGAAGGAGGAGAAGAAAGG + Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
950902541 3:16511131-16511153 ATGACTGAGAATGAGGATGAAGG + Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952710214 3:36423867-36423889 AAGAAGAAAGATGAGGAGGAAGG - Intronic
952917063 3:38254623-38254645 AGGAACAAGGATGGGGAGGTAGG + Exonic
952962557 3:38601861-38601883 ATCAACAAGGATGGGAAGGAAGG - Intronic
953027208 3:39152210-39152232 ATGGGTAAGGAACAGGAGGAGGG + Intronic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953525380 3:43686105-43686127 AGGAATGAGGAAGAGGAGCATGG - Intronic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955080489 3:55653965-55653987 AGGAATGAGGAGGAAGAGGAGGG - Intronic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955510923 3:59679524-59679546 ATGAGTAAGAAGGAGGAGGGTGG + Intergenic
955728645 3:61959997-61960019 ATATATAAGGATGAGGGGAAGGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
957150061 3:76475334-76475356 TTGAATGAGGATGAAGTGGAAGG + Intronic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
959089220 3:101884642-101884664 AGGAAGAAGGATGGAGAGGAAGG + Intergenic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
959459381 3:106605941-106605963 ATGAATGAGGAAGAGGAGTGTGG + Intergenic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960496562 3:118382740-118382762 AGGAAGAAAGATGAGAAGGAGGG + Intergenic
960953186 3:123012756-123012778 ATGAAGGAGGAAGAGGAGGGGGG - Intronic
961115169 3:124323217-124323239 ATGAAAAAGGATGGGGAGGCTGG - Intronic
961221691 3:125206032-125206054 ATGAATGCAGCTGAGGAGGAAGG - Intronic
961346733 3:126268120-126268142 ATGCAGGAGGATGAAGAGGACGG - Intergenic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
961978931 3:131056068-131056090 ATGAATGAGGGTGGGGAGAAGGG + Intronic
962584787 3:136831160-136831182 ATGAATGAGGCTGCTGAGGAGGG + Intronic
962815698 3:138996147-138996169 AAGAATAAAGCTGAAGAGGAAGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
962914667 3:139888968-139888990 ATGAAGAAGGAAGGGAAGGAAGG - Intergenic
963003973 3:140708772-140708794 AAGAGAGAGGATGAGGAGGAAGG + Intergenic
963261300 3:143193815-143193837 ATGATCAAAGCTGAGGAGGAGGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964501636 3:157354526-157354548 ATGAATAAGGAGAAGCAGCAAGG - Intronic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966062641 3:175778164-175778186 ATTACTAGGGATGTGGAGGAAGG + Intronic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966635969 3:182134120-182134142 ATAAATAAAGAAGAGGAGAAAGG + Intergenic
966981357 3:185139138-185139160 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
967275360 3:187768800-187768822 ATCAATTTGGATGAGGTGGAAGG + Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968161612 3:196431965-196431987 ATGAAGGAGGAGGAGGAGGGCGG + Intronic
968313556 3:197703741-197703763 ATGAATGAGGAGGAGGGTGAAGG + Intronic
968359965 3:198139827-198139849 AGGACAATGGATGAGGAGGAGGG + Intergenic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
968979168 4:3837407-3837429 ATGGATAAGGATGGAGAGGCAGG + Intergenic
969511386 4:7620017-7620039 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969511391 4:7620033-7620055 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
970162080 4:13199026-13199048 GAGAACAAGGATGAAGAGGAAGG + Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970746578 4:19305292-19305314 ATGAACAAGGATGAGAATTAGGG - Intergenic
971146002 4:23976972-23976994 AGGAAGAAGGAGGAGGAAGAGGG + Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
971639162 4:29106773-29106795 ACTAGTAAGGATGAGGAGAAAGG - Intergenic
972263226 4:37432842-37432864 ATGAAAAAGGAAGAGGGGAAAGG + Intronic
972939145 4:44176210-44176232 ATAAATCAGAATCAGGAGGAAGG + Intronic
973278838 4:48338542-48338564 ATGAAACAGGATTAAGAGGATGG + Intergenic
973966670 4:56170088-56170110 ATGGAGGAGGAAGAGGAGGAAGG - Intergenic
974031330 4:56779351-56779373 ATGACTTAGGATTAGGAAGAAGG + Intergenic
974751100 4:66142365-66142387 ATAGATAAGAAAGAGGAGGAAGG - Intergenic
974816970 4:67017677-67017699 TTGAATAATGATGATGATGATGG - Intergenic
975495415 4:75030890-75030912 ATGTAAGAGGAGGAGGAGGAGGG + Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976001706 4:80381871-80381893 AGGAAAAAGGAACAGGAGGAAGG - Intronic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976858505 4:89632570-89632592 AAGAGTAAGGATGAGTGGGATGG + Intergenic
977289766 4:95151781-95151803 ATGATTTAGGATAGGGAGGAGGG + Intronic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
977927324 4:102716011-102716033 ATTAAAAAGAATGAGGAGGCCGG + Intronic
978257265 4:106707898-106707920 GTGAATTAAGATGATGAGGAAGG + Intergenic
978350300 4:107814044-107814066 ATGCAGGAGGATGAGGTGGAAGG + Intergenic
978360240 4:107923883-107923905 ATTAAAAAGGATGAGGCTGATGG + Intergenic
978863765 4:113482387-113482409 AAGACTAAGGATGATGATGAAGG + Intronic
979952091 4:126906098-126906120 ATGAGAAATGATGAGAAGGAAGG - Intergenic
980177687 4:129366463-129366485 ATCAATAAGGAAGACGAAGATGG + Intergenic
980742568 4:136972046-136972068 AAGAAGAAGGATGAAGAAGAAGG + Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981087861 4:140702167-140702189 AGGAATAAGGTTGAGGATCAGGG + Intronic
981744704 4:148041196-148041218 ATGTTTAAGAATGAGGAGCATGG + Intronic
982057081 4:151562273-151562295 ATGAAGAAGGAGGGGTAGGAAGG + Intronic
982068890 4:151677931-151677953 AGGAAGAAGGAGGAGGAGGGAGG - Intronic
982122764 4:152158359-152158381 ATCAATAATGCAGAGGAGGAGGG + Intergenic
982125178 4:152178043-152178065 AGTAATAAGGAGGAGGAGGAAGG + Intergenic
982309708 4:153972108-153972130 ATGACTCAGGGTGAGGAGGTTGG + Intergenic
982589174 4:157282554-157282576 AGGAGTAAGGATGAGGCAGACGG + Intronic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
983030112 4:162790018-162790040 ATGAATAAGGAAGAAGAACAAGG + Intergenic
983139340 4:164129212-164129234 ATGATTAAGAAGGAGGAAGAAGG + Intronic
983414196 4:167435278-167435300 ATTAATAAGGATGATGATAAAGG + Intergenic
983519548 4:168693006-168693028 ATAAATTTGGATGAGGAGGGAGG + Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983928940 4:173432422-173432444 AGGAAGAAGGAGGAGAAGGAAGG - Intergenic
984226982 4:177046889-177046911 TTCAATAAGGATGAGAAGAAAGG + Intergenic
984588853 4:181594188-181594210 ATGAATAAGCATGATGAATAAGG + Intergenic
984895465 4:184535705-184535727 TTGAATAATGATGATGATGATGG + Intergenic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985112739 4:186562916-186562938 AACATGAAGGATGAGGAGGAGGG - Intergenic
985773541 5:1827798-1827820 ATGAAGTGGTATGAGGAGGAGGG + Intergenic
985857323 5:2440005-2440027 AAGAATGAGGATGATGATGATGG - Intergenic
985985350 5:3510982-3511004 ATAAAGAGGGATGAAGAGGAAGG + Intergenic
986026212 5:3853792-3853814 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
987001539 5:13664848-13664870 AAGAAGGAGGATGAGAAGGAGGG + Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987261872 5:16212532-16212554 AAGAATAAGTTTCAGGAGGAAGG - Intergenic
987359394 5:17093026-17093048 ATGAATGAGGGAGAGAAGGAAGG + Intronic
987368072 5:17167749-17167771 ATGAAAAAGGATGAGGGGTGAGG + Intronic
987747925 5:22001299-22001321 ATTAATAAGGAGGAGGGGGACGG - Intronic
987851289 5:23358754-23358776 AAGGAAGAGGATGAGGAGGAGGG - Intergenic
987900296 5:24002336-24002358 AAGAAGAAGGATGAGCGGGAAGG + Intronic
987961470 5:24814585-24814607 CTGAATTTGGATGAGGAAGAGGG + Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988632071 5:32942294-32942316 AAGAAGAAGGAGGAGGACGAGGG + Intergenic
988917479 5:35909393-35909415 ATGAATGAGGATGAGTGTGAAGG + Intronic
990088427 5:52008540-52008562 ATTAATAAAGATGAAAAGGAAGG + Intronic
990681522 5:58249897-58249919 AGGAAGAAGGAAGAGGAGAAGGG + Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991336913 5:65559097-65559119 ATGAATAAAGATATTGAGGAGGG - Intronic
991449407 5:66736149-66736171 ATGAATAAAGATGGAAAGGAAGG - Intronic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992125968 5:73641842-73641864 ATTAATAATGAAGAGGATGATGG + Intronic
992150784 5:73900714-73900736 ATAAACAAGGTTTAGGAGGAAGG - Intronic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
994493230 5:100475218-100475240 ATGAATATTGAGGTGGAGGAAGG - Intergenic
994801680 5:104385132-104385154 AAGAATAAGTAGGAAGAGGAGGG - Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995420097 5:111955000-111955022 ATGAAGATGCATGAGGAAGAAGG + Intronic
995518307 5:112976083-112976105 ATGAATAAGGACGAGCAGGTGGG + Intergenic
995856165 5:116594491-116594513 ATGAATAAGAATGTAGAGAAAGG - Intergenic
996344169 5:122471798-122471820 AAGGATGAGGGTGAGGAGGAGGG - Intergenic
996599981 5:125251958-125251980 CTGATTAAGGATGATGAGAAAGG + Intergenic
996856484 5:128013752-128013774 AAGAATAAAGGTGGGGAGGAGGG + Intergenic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
997262307 5:132474612-132474634 ATGAAGAAGGAGGAGGCAGAAGG - Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
998034909 5:138906991-138907013 AGAAAGAAGGAGGAGGAGGAAGG - Intronic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
998566092 5:143217167-143217189 ATGAATAAGGAAGAGGAAAAGGG + Intronic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998733992 5:145113808-145113830 ATGAATAAGGATGAGATGGGAGG - Intergenic
998845707 5:146307626-146307648 ATGAAGAAGGATTTGGATGAAGG + Intronic
998909560 5:146944050-146944072 AGAGATAAGGATGAGGAGGCTGG - Intronic
998915745 5:147009524-147009546 AAGACGAAGGATGAGGTGGAAGG + Intronic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
1000078968 5:157826058-157826080 AGGAAGAAGGGAGAGGAGGAAGG + Intronic
1000456131 5:161451690-161451712 ATGAAGAATGATGGTGAGGAGGG + Intronic
1000887119 5:166759803-166759825 AGCAGTAAAGATGAGGAGGAAGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1003965603 6:11249620-11249642 ATGACTAAGGAAGAGGAGAATGG + Intronic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004266453 6:14152085-14152107 AGGAAGAAGGAAGAGGAAGAAGG - Intergenic
1004372761 6:15066784-15066806 ATAAATAGGGAGGAGGAAGAAGG + Intergenic
1004861790 6:19811453-19811475 ATGGATAATGATGAGGGTGAGGG - Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005084257 6:21988082-21988104 ATGACTAGGAATGAGGATGAAGG - Intergenic
1005092959 6:22078468-22078490 ATGCATAGGGATGGGCAGGAAGG + Intergenic
1006066433 6:31465630-31465652 ATGGATGAGTAAGAGGAGGAAGG - Intergenic
1006299594 6:33186492-33186514 ATGAATGAGGACTAGGAGGAGGG + Intronic
1006715571 6:36117398-36117420 AGGAATGAGGAGGAGGAAGAGGG - Intergenic
1007235615 6:40389716-40389738 ATGAATGAGAAAGATGAGGAGGG + Intergenic
1007318923 6:41012254-41012276 ATGACAATGGCTGAGGAGGAAGG - Intergenic
1007714514 6:43848026-43848048 ATGAAGAAGGAGGAGGAAGGTGG + Intergenic
1007832071 6:44646408-44646430 ATCAAAGAGGAAGAGGAGGAGGG - Intergenic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009567306 6:65325205-65325227 ATGAAGAAGGGAGAGGAGGAGGG - Intronic
1009997164 6:70908695-70908717 ATGACTAAGGATAAGGATAAAGG + Intronic
1010108935 6:72201969-72201991 ATGAATAAGTATGATACGGAAGG - Intronic
1010311383 6:74389880-74389902 AAGAAGAAGGAAGAAGAGGAAGG - Intergenic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1010658202 6:78537606-78537628 AGAAATGAGGATGATGAGGATGG + Intergenic
1010790199 6:80055092-80055114 ATGAGTAAGTATGAAGAGCATGG - Intergenic
1011165622 6:84442715-84442737 ATGAACAGGAATTAGGAGGAGGG + Intergenic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012301171 6:97590264-97590286 ATGAATAAGGAGGAAGGGAAAGG - Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1012990662 6:105922586-105922608 AAGAAGGAGGAAGAGGAGGAAGG + Intergenic
1013128590 6:107209501-107209523 ATCAATAAGGGTTGGGAGGAGGG + Intronic
1013545421 6:111152132-111152154 ATGGATAAGTATGAACAGGAAGG - Intronic
1013732911 6:113190165-113190187 AGGAAGAAGGCTGAGGAAGATGG - Intergenic
1014323405 6:119961109-119961131 AAGCATAAGGATGATGATGATGG - Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014757200 6:125314485-125314507 AGGAAAAAGGAAGAGGAAGAGGG + Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015847563 6:137536701-137536723 AAAAACAAGGATGAAGAGGAAGG - Intergenic
1017339640 6:153305453-153305475 AAGAAGAAGGAGGAGGAGTAGGG - Intergenic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1017674076 6:156795753-156795775 AATAATAAGGAAGAGAAGGAAGG - Intronic
1017892889 6:158653959-158653981 AAGAAAAGAGATGAGGAGGATGG - Intronic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1018996516 6:168714491-168714513 ATGATTGATGATGAGGATGATGG + Intergenic
1018996575 6:168714884-168714906 GAGAATGATGATGAGGAGGAGGG + Intergenic
1018996717 6:168715822-168715844 GAGAATGATGATGAGGAGGATGG + Intergenic
1019260024 7:76794-76816 AGGACAATGGATGAGGAGGAGGG - Intergenic
1019703204 7:2484451-2484473 ATGTTTATGGATGAGGAGTAAGG - Intergenic
1019860237 7:3651994-3652016 ATGAATGAGTTTGAGGAAGAAGG + Intronic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1020906017 7:14065658-14065680 AAAAAAAAGAATGAGGAGGAAGG - Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022521998 7:31014405-31014427 ATGAAGAAGGATGGGCAGAAGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023215604 7:37859307-37859329 AAGAATAAGCATTAGAAGGATGG - Intronic
1023279899 7:38558568-38558590 AGGAATAATGATGGGAAGGAGGG + Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024822286 7:53346718-53346740 GAGAAGGAGGATGAGGAGGAGGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025243908 7:57301536-57301558 ATGAAGGAGGCTGAGGTGGAAGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1025815235 7:64904622-64904644 GTGAATTAGGATGAGGAAGTTGG - Intronic
1025887791 7:65614601-65614623 AGGAAGAAGGAGGAAGAGGAAGG - Intergenic
1026002966 7:66577063-66577085 ATGAATGAGGAAGGGAAGGAGGG + Intergenic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1026499946 7:70935629-70935651 CTGAATAAGGAAGAGGGGGCAGG - Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026566895 7:71496608-71496630 ATGAGGGAGGGTGAGGAGGAAGG + Intronic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026645195 7:72161379-72161401 AAGAATAAGGTGGAGAAGGATGG + Intronic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027645317 7:80790324-80790346 AGGAGAAAGGAGGAGGAGGAAGG + Intronic
1027702896 7:81490979-81491001 ATAGATAAGGATGAGGGTGAGGG - Intergenic
1027825141 7:83103781-83103803 ATAAATAATGATGGTGAGGAAGG - Intronic
1027859689 7:83561468-83561490 ATGATTAGGGATTAGGAGGCAGG - Intronic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028425616 7:90684470-90684492 ATCAACAAGGATGGGGAAGAAGG - Intronic
1028534552 7:91878021-91878043 ATGGATAGGCATCAGGAGGATGG - Intronic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030108750 7:106008821-106008843 AGGAACAAGGAAGAGCAGGAGGG - Intronic
1030509040 7:110460483-110460505 AAGAAGATGGAAGAGGAGGAGGG + Intergenic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1030638259 7:111974576-111974598 AGGAAAAGGGATGGGGAGGAGGG + Intronic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032303888 7:130714526-130714548 ACAAATAAGGAACAGGAGGATGG - Intergenic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032824257 7:135553863-135553885 GTGAATAAGGAAGGGAAGGAAGG + Intergenic
1032908741 7:136404483-136404505 AGGAAAAAGGATGAGGAGGGAGG - Intergenic
1033301784 7:140192621-140192643 ATGAAGAAGGAAGAGAAGAAAGG + Intergenic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1033735569 7:144218328-144218350 AAGAATAAAGATGAATAGGAAGG + Intergenic
1033747485 7:144332642-144332664 AAGAATAAAGATGAATAGGAAGG - Intergenic
1034182763 7:149151009-149151031 ATGAATAAGAATCAGCTGGAGGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034322188 7:150196600-150196622 ACAAATAAGGATGAGGAATATGG - Intergenic
1034770553 7:153770614-153770636 ACAAATAAGGATGAGGAATATGG + Intergenic
1034859339 7:154582536-154582558 AGGAAACAGGAGGAGGAGGAAGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035100185 7:156389826-156389848 AGGAAGAAGGCTGAGGGGGAGGG - Intergenic
1036126605 8:6068653-6068675 AGGAATGAGGAGGAGAAGGAAGG - Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1037041694 8:14244258-14244280 AAGAATGAGGAAGAGGAAGAAGG - Intronic
1037297683 8:17418408-17418430 GTGAAAAAGGAAGAGAAGGATGG - Intergenic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038368375 8:26961307-26961329 ATCTATAAAGATGAGGAGCAAGG - Intergenic
1038390922 8:27200092-27200114 ATGGAAATGGATGAAGAGGAAGG - Intergenic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1039258105 8:35741013-35741035 ATGAATGAGAGTGAGGAGGATGG - Intronic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040904435 8:52451388-52451410 AGGAAAATGGATGAGTAGGAAGG + Intronic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041291155 8:56310085-56310107 AAGAAGGAGGAAGAGGAGGAAGG + Intronic
1041291175 8:56310146-56310168 AGGAGGAAGGAGGAGGAGGAGGG + Intronic
1041291185 8:56310178-56310200 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291190 8:56310194-56310216 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291195 8:56310210-56310232 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291200 8:56310226-56310248 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291205 8:56310242-56310264 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291210 8:56310258-56310280 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291215 8:56310274-56310296 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291220 8:56310290-56310312 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291224 8:56310303-56310325 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291229 8:56310319-56310341 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041607954 8:59806784-59806806 TTGAATAAGGGTGATAAGGATGG - Intergenic
1041770037 8:61463447-61463469 ATGATTAAGCTTGGGGAGGAAGG - Intronic
1041831536 8:62160688-62160710 AAGAAGTAGGAGGAGGAGGAAGG + Intergenic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042909961 8:73816536-73816558 GGGAATGAGGATGAAGAGGAAGG + Intronic
1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG + Intergenic
1043738309 8:83775136-83775158 ATGGAAAAGGATGTGGAGGCAGG - Intergenic
1044460987 8:92443684-92443706 ATGAAGAAGGAGGAGCAGGTTGG + Intergenic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045451545 8:102331760-102331782 ATGAATTAGGGAGAGAAGGATGG - Intronic
1045904988 8:107334039-107334061 ATGGATAAATATGAGAAGGAGGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1046844510 8:118900893-118900915 ATGAATCAGCCTGGGGAGGAAGG + Intergenic
1047112938 8:121811116-121811138 AAGATGAAGGAAGAGGAGGAGGG + Intergenic
1047348803 8:124053954-124053976 ATGAGTCAGGATAGGGAGGACGG - Intronic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047984779 8:130221277-130221299 AGGAAGAAGGGAGAGGAGGATGG + Intronic
1048210205 8:132448551-132448573 AGTAAAAAGGAGGAGGAGGAAGG + Intronic
1048317294 8:133371606-133371628 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1048402304 8:134083361-134083383 AAAAAAAAGGAAGAGGAGGATGG - Intergenic
1048462895 8:134637469-134637491 CTGAATTTGGGTGAGGAGGAAGG - Exonic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1048889422 8:138934437-138934459 AAAAAGAAGGAAGAGGAGGAAGG + Intergenic
1048889632 8:138936053-138936075 CTGAGGAAGGATGTGGAGGAGGG + Intergenic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049268063 8:141680101-141680123 ATGCATGTGGATGAGGATGATGG + Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049353803 8:142177925-142177947 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1049530447 8:143151878-143151900 AGGAATAAAGTTGAGGAGGGAGG + Intergenic
1050180028 9:2912210-2912232 AAGAATAAGGATGAGAATAAGGG + Intergenic
1051351862 9:16204898-16204920 ATGCATAGGGAGGAGAAGGATGG + Intronic
1051594626 9:18811710-18811732 ATGAATAAGGGTGATGAAGGTGG - Intronic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1052003685 9:23320234-23320256 AGAAAGAAGGAAGAGGAGGAGGG + Intergenic
1052337051 9:27330741-27330763 ATGAATAAGGCTTAGCATGAGGG + Intronic
1053216198 9:36272658-36272680 ATGGATTGGGAAGAGGAGGAAGG + Intronic
1053820931 9:41966190-41966212 ATTAAGAAGGAAGGGGAGGAGGG - Intronic
1054130776 9:61362147-61362169 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1055155301 9:73055563-73055585 ATGAATAAGAATGATGAGACTGG - Intronic
1055558909 9:77503059-77503081 AAGAATAAGGAAGATGAGCAGGG - Intronic
1056342694 9:85653229-85653251 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1057565644 9:96164071-96164093 ATGAATTAGGAAGAGGAGCGGGG + Intergenic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1058027382 9:100156577-100156599 ATCAATAAGGATGGGAAGGAGGG - Intronic
1058187979 9:101877543-101877565 ATCAAGGAGTATGAGGAGGACGG + Intergenic
1058267547 9:102923417-102923439 ATCAATGAAGATGAGGATGAAGG + Intergenic
1058561434 9:106233138-106233160 AGGAGAAAGGAGGAGGAGGAAGG - Intergenic
1058561444 9:106233184-106233206 AGGAATGAGGAGGAGGAAGAAGG - Intergenic
1058561453 9:106233233-106233255 AGGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058700002 9:107592040-107592062 ATGAGGAAGGGTGAGGATGAGGG + Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1059072451 9:111152917-111152939 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072458 9:111152943-111152965 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1059072463 9:111152959-111152981 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072467 9:111152972-111152994 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072471 9:111152985-111153007 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072476 9:111153001-111153023 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059240154 9:112797443-112797465 ATAATTAAGGATGAGTAGGTGGG - Intronic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1059823221 9:117997235-117997257 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1060565931 9:124591647-124591669 ATTAATTAGGATGAGAAGCATGG - Intronic
1060623584 9:125090395-125090417 AGGAAGGAGGATGATGAGGAAGG + Intronic
1061224995 9:129276312-129276334 CTCAAGAAGGATGAGGAGGGAGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062151653 9:135022445-135022467 ATGAGAAAGGCCGAGGAGGAAGG - Intergenic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1185521777 X:745657-745679 CTGGATGAGGATGAGGAGGGTGG - Intergenic
1185550763 X:981100-981122 ATGGAGGAGGACGAGGAGGAGGG + Intergenic
1185661926 X:1735195-1735217 AGGAGGAAGGAGGAGGAGGAGGG - Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1185814997 X:3146430-3146452 AAGGATGAGGAAGAGGAGGAGGG - Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185957394 X:4506280-4506302 ATGTAAAAGGATGAGGGGGCTGG + Intergenic
1186095834 X:6100897-6100919 ATTGAGAAGGATGAGGAGAAAGG - Intronic
1186463474 X:9766061-9766083 AGGAAGAGGGAGGAGGAGGAGGG + Intronic
1187025685 X:15433659-15433681 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025690 X:15433682-15433704 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025695 X:15433705-15433727 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025700 X:15433728-15433750 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025705 X:15433751-15433773 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025710 X:15433774-15433796 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025715 X:15433797-15433819 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025720 X:15433820-15433842 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025725 X:15433843-15433865 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025734 X:15433886-15433908 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025752 X:15433955-15433977 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025770 X:15434041-15434063 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025791 X:15434127-15434149 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1190441256 X:50476588-50476610 ATGAAAAAGGTTGGGGAAGAAGG + Intergenic
1190475939 X:50827466-50827488 ATGGACAAGGATGAAGTGGAGGG - Intergenic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1192106013 X:68317664-68317686 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1192185181 X:68941831-68941853 AGGAGAAAGGAGGAGGAGGAAGG + Intergenic
1192262055 X:69511349-69511371 AAGAAAAAGGATGGGGAGAAGGG - Intronic
1192436443 X:71146103-71146125 AAGAAAAAGGAAGAGGAGGGAGG - Intronic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1193366251 X:80637437-80637459 ATGAACAAGGATGAGTAAAAAGG - Intergenic
1193630242 X:83876658-83876680 ATGAAATAAGATGAGGAGGGAGG - Intronic
1193905027 X:87231820-87231842 ATGAGCAAGGATGAGGAGCAAGG + Intergenic
1193917849 X:87388025-87388047 ATGAATAAGGCCGAGCAGGGTGG - Intergenic
1194843999 X:98780758-98780780 ATTAATAATGATGATGATGATGG - Intergenic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195450626 X:105008264-105008286 ATGCATGAGGATGATGAAGATGG + Intronic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195964095 X:110414409-110414431 AGGAAAAAGGATGAGGGGAAAGG + Intronic
1197742758 X:129908017-129908039 AACAATCAGGATGAGGGGGAGGG - Intronic
1198133041 X:133717976-133717998 AGAAATAAGGCTGAGGTGGAAGG + Intronic
1198334248 X:135651603-135651625 AGGAATCTGGCTGAGGAGGAAGG + Intergenic
1198339400 X:135699484-135699506 AGGAATCTGAATGAGGAGGAAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199658520 X:150022838-150022860 ATGAACAAGGATGAGAAAGGGGG - Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic
1201502842 Y:14664015-14664037 ATTGAGAAGGATGAGGAGAAAGG + Intronic