ID: 962884798

View in Genome Browser
Species Human (GRCh38)
Location 3:139614324-139614346
Sequence CAGAAAGTAGGGAAGTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962884798_962884802 19 Left 962884798 3:139614324-139614346 CCTGACTACTTCCCTACTTTCTG 0: 1
1: 0
2: 1
3: 19
4: 241
Right 962884802 3:139614366-139614388 GCTCTCACCAAATCTGTGTTTGG 0: 1
1: 0
2: 2
3: 10
4: 125
962884798_962884803 20 Left 962884798 3:139614324-139614346 CCTGACTACTTCCCTACTTTCTG 0: 1
1: 0
2: 1
3: 19
4: 241
Right 962884803 3:139614367-139614389 CTCTCACCAAATCTGTGTTTGGG 0: 1
1: 0
2: 0
3: 14
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962884798 Original CRISPR CAGAAAGTAGGGAAGTAGTC AGG (reversed) Intronic
901203519 1:7480658-7480680 CAGAAAGGAGGGAGATAGCCGGG - Intronic
901235944 1:7667665-7667687 CAGAAAGGACAGAAGGAGTCAGG - Intronic
903639384 1:24848259-24848281 CAGGAAGGAGGGAAGGAGGCCGG - Intergenic
905506859 1:38486627-38486649 TAGAAAGAAGGGAAGAAGGCAGG + Intergenic
906665203 1:47616459-47616481 CAGAAAGTAGGGAAGGACACTGG + Intergenic
909816956 1:80006566-80006588 CAGAAAGCAGGGAACTGCTCAGG - Intergenic
910062836 1:83114203-83114225 CTTAAAGTAGGGAATTACTCAGG - Intergenic
912018490 1:105072569-105072591 CAGAAAGTAAGGACTTTGTCTGG - Intergenic
912085255 1:105994252-105994274 CAGAAAGTAGAATAGTAGTTGGG - Intergenic
912152292 1:106875173-106875195 CAGAAACTAGGGAAGAGGTAAGG - Intergenic
912193906 1:107375940-107375962 CAGAGAGTAGGTGACTAGTCAGG + Intronic
912716202 1:111985420-111985442 GGGAAAGTTGGGAAGTGGTCTGG - Intronic
913161216 1:116147626-116147648 CAGAAAGGAGGGAAATAGACTGG + Intergenic
913538664 1:119798042-119798064 CAGACAGAAGGGAAGAACTCAGG + Intronic
915180568 1:154055554-154055576 CAAAAATTAAGGAATTAGTCAGG - Intronic
915192451 1:154163103-154163125 TAGAAAGGAAGGAAGTAGACCGG - Intronic
916431699 1:164736170-164736192 CAGATTGTAATGAAGTAGTCAGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
918318586 1:183343918-183343940 AAGAAAGTAGGGATGTTGGCTGG - Intronic
919438833 1:197600773-197600795 GAGAAAGTATGGAAGCAGTTAGG - Intronic
919571238 1:199251147-199251169 CAGAAAGTTGGGAAGTACAAGGG + Intergenic
921672467 1:217941503-217941525 TAGAGAGTAAGGAAGTTGTCAGG + Intergenic
922768784 1:228170841-228170863 GAGAGAGAAGGGAAGGAGTCAGG + Intronic
923330148 1:232916184-232916206 CAGCAAGTTGGGAGGAAGTCTGG - Intergenic
923549734 1:234954036-234954058 CAGAAAGGAGGGAAGGAGGACGG + Intergenic
1064693223 10:17939286-17939308 CGGAAGGTTGGGAAGTAGTTTGG + Intergenic
1067084757 10:43231870-43231892 CAGAAAGTAGAGAAGAAGCCAGG + Intronic
1068066239 10:52135622-52135644 GAGAAATTAGGGATGTAGTTGGG + Intronic
1069202051 10:65632086-65632108 CAGAAAGTAGGAGAGTAGAAAGG - Intergenic
1071033712 10:81216500-81216522 GAGAAAGAAGGGAAGGAGACAGG + Intergenic
1071530579 10:86388107-86388129 CAGAAAGGATGGAAGTTGCCGGG - Intergenic
1072528826 10:96299014-96299036 GAGAAAGAAGGGAAGGAATCAGG - Intergenic
1072873175 10:99142629-99142651 TAGAAAGTAAGCAAGTTGTCAGG + Intronic
1073263527 10:102208694-102208716 AGGAAAGTGGGGAAGTAGTATGG - Intergenic
1073741416 10:106411889-106411911 CATAAAGAAGGGAGGCAGTCTGG - Intergenic
1074698139 10:116069442-116069464 CAGAATGTAGGGAAGGCGTTTGG - Intronic
1077831925 11:5882197-5882219 CAGAAAGAAGGCAAGAATTCAGG + Intronic
1078421199 11:11214447-11214469 CAGAAAGCAAGGAAGGAATCAGG + Intergenic
1078571699 11:12463993-12464015 CAGAAAGGAAGGAAGTACTCAGG - Intronic
1080355734 11:31443522-31443544 CAGAATGTGGGCAAGTAGTTAGG - Intronic
1081316931 11:41641437-41641459 CTGAAAGTAGGGAAACACTCTGG + Intergenic
1082091059 11:48090254-48090276 CAGAAAGAAGGGAAGGATGCAGG - Intronic
1084124964 11:67093451-67093473 CAGAAATTACAGTAGTAGTCAGG + Intergenic
1084729923 11:71066286-71066308 CAGAGAGTGGGGAAGTTGTGGGG + Intronic
1085555056 11:77412008-77412030 AAGAAAGGAGGGAAGGAGGCGGG + Intronic
1086231929 11:84579723-84579745 CATAAACTAGGGAAGTATGCAGG + Intronic
1087144064 11:94794633-94794655 CAGAAAGGAGGGAAGCAGGGAGG - Intronic
1087385341 11:97462598-97462620 CAGAAATGAGGGAAGAAATCGGG + Intergenic
1090923235 11:131226696-131226718 CAGAAAGGAGGAAACTAGCCTGG - Intergenic
1091175346 11:133552921-133552943 CATGAAGGAGGGAAGGAGTCAGG + Intergenic
1094038710 12:26099841-26099863 CAAAATGTAATGAAGTAGTCAGG - Intergenic
1094218845 12:27972343-27972365 AAGAAAGGAGGGAAGGAGTGGGG - Intronic
1094659062 12:32448736-32448758 AAGATAGAAGGGAAGCAGTCCGG + Intronic
1097849023 12:64393279-64393301 CAGAAAGAAGGGAATTTGACTGG + Intergenic
1097999276 12:65923084-65923106 AAGAAACTAGGGAAATGGTCAGG - Intronic
1098027105 12:66215254-66215276 GAGAGAGTAGGAAAGTAGACTGG - Intronic
1098945326 12:76583172-76583194 CAAAAAGTAGGGAGGAAGTTAGG + Intergenic
1099764001 12:86959470-86959492 CAGGAAGTAGAGAAGGAGACGGG - Intergenic
1100840726 12:98609466-98609488 CAGAAACTTGTGTAGTAGTCAGG - Intergenic
1101111089 12:101486543-101486565 CAGAAATTACGGAAGAAGTGGGG + Exonic
1101992995 12:109502652-109502674 CAGAAAATAGAGATGTAGCCAGG + Intronic
1103376700 12:120462029-120462051 CTGAAAGGAGAGAAGTAGTGTGG + Exonic
1107700454 13:43041940-43041962 GAGTAAGCTGGGAAGTAGTCAGG + Intronic
1107828663 13:44353995-44354017 TTGAAAGGAGGGAAGTAGGCTGG + Intergenic
1113847206 13:113399253-113399275 CAGAAGGGAGGGAAGGAGTATGG - Intergenic
1114305036 14:21415111-21415133 CAGAGATTAAGGAACTAGTCTGG + Intronic
1114338963 14:21723356-21723378 CAGAAAGAAGGGAAATAGGATGG - Intergenic
1114839878 14:26250874-26250896 AGGAAAGGAGGGAGGTAGTCAGG + Intergenic
1116722044 14:48509394-48509416 GAGAAAGGAGGGAGGGAGTCAGG + Intergenic
1118102788 14:62625379-62625401 CAGAAACAAAGGAAGTAGACTGG + Intergenic
1118440406 14:65806651-65806673 CAGAGAGAAGGGAAGGAGTTGGG - Intergenic
1121423742 14:93833601-93833623 CAGAAAGGAGGGAAATAGCAGGG - Intergenic
1124057419 15:26254782-26254804 CATAAAGTGGGGAAGGATTCTGG - Intergenic
1124063165 15:26314373-26314395 AAGAAAGAAGGGGAGTACTCAGG - Intergenic
1124427477 15:29574044-29574066 CAGAAAGAAGGGAAGGAGAAAGG + Intergenic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1126377724 15:48012845-48012867 GAGATAGAAGGGAAGTAGTGAGG - Intergenic
1127220079 15:56870508-56870530 CAGTAAGTGGGGAAGATGTCAGG + Intronic
1127808937 15:62546508-62546530 CAGAAAGCTGGGAAGTGTTCTGG + Intronic
1128015140 15:64338249-64338271 CAGAAAGTAAAAAAGTAGTGAGG - Intronic
1128088818 15:64905234-64905256 AAGAAAGTAGGGAATTACTATGG - Intronic
1129450109 15:75646973-75646995 CAGCAAGGAGAGAAGTGGTCAGG - Intronic
1131109294 15:89754752-89754774 CAGAAAGAAGGGATGTCATCTGG - Intergenic
1131135558 15:89932334-89932356 CAGAAGGTAGGGTAGTGCTCTGG - Intergenic
1131729518 15:95264931-95264953 CAGCAAGTAGGGCAGAAGTTGGG + Intergenic
1131797248 15:96031713-96031735 CAGAAAGTAGGAAAGAGGGCAGG - Intergenic
1133477848 16:6140638-6140660 CAGACAGGAGGGAAGGAGTTGGG - Intronic
1136069239 16:27778214-27778236 CACAGAGTGGGGAAGCAGTCAGG + Intronic
1138456532 16:57124381-57124403 CAGAAAATAGGAAAATAGTGAGG - Intronic
1140040261 16:71402790-71402812 CAGAAACCAGGGAAGTCGTTTGG - Intergenic
1140584102 16:76268173-76268195 CAGAAGATAGGGAAGCAGTGGGG + Intergenic
1141397418 16:83717333-83717355 CAAAAAGTGGGGAAGAAGTCAGG - Intronic
1144877714 17:18411095-18411117 CAGAAGGTGGGGAAGAAGACTGG - Intergenic
1145154515 17:20533308-20533330 CAGAAGGTGGGGAAGAAGACTGG + Intergenic
1145406907 17:22607789-22607811 CAAAAAATAGGAAAGTATTCTGG - Intergenic
1148785565 17:50144588-50144610 GAGGAATTAGGGGAGTAGTCAGG - Intronic
1148929349 17:51115533-51115555 CAAAAAGGAGGGAAGGAGCCAGG + Intronic
1150067927 17:62127151-62127173 AAGGAAGTAGGGAAGTAGCAAGG - Intergenic
1151112609 17:71696770-71696792 CAGAAAGTAAGGAAGTACAAAGG + Intergenic
1153299857 18:3583101-3583123 CAGAAAGGTGGGAAGTGGCCGGG - Intronic
1155012441 18:21793243-21793265 CAGAAAGGATGGAACTAGTGTGG + Intronic
1156249880 18:35342922-35342944 TAGAAAGCACTGAAGTAGTCTGG - Intronic
1156351789 18:36308409-36308431 CACAAAGAAAGGAAGAAGTCAGG - Intronic
1157907603 18:51583595-51583617 AAGAAAGCAGGGAAGGAGTCAGG + Intergenic
1159908722 18:74123047-74123069 AAGAAAGAAGGGAAGAAGTCTGG + Intronic
1164434599 19:28218702-28218724 AAGAAAGGAGAGAAGAAGTCCGG - Intergenic
1164630829 19:29760465-29760487 CAGAAAGTGGAGACCTAGTCAGG - Intergenic
1165187096 19:34031754-34031776 CAAAAAGTGGGGAAGTCGCCGGG + Intergenic
1165820283 19:38670496-38670518 CAAAATGGAGGGAAGTAGCCTGG + Intronic
1166458190 19:42962274-42962296 AGGAAAGTAGGGAAGCAGTGAGG + Intronic
1166580438 19:43893831-43893853 AAGAAAGTAGGTAAGTGGGCTGG - Intronic
1166592978 19:44017697-44017719 CAGAAATTAGGAAAGAAGGCTGG + Intergenic
928599307 2:32887526-32887548 CAGAAAGTAAGGAAGTGCTGGGG + Intergenic
928704467 2:33933255-33933277 GAGAAAGAAGGGAAGAAGGCAGG - Intergenic
929334784 2:40728539-40728561 AAGAAAATAGGGAAATAGTTGGG + Intergenic
930696846 2:54420395-54420417 CAGATAGTAGGGAAAAAGACAGG - Intergenic
934999345 2:98997658-98997680 CAGAAAGTAGGAGTGTTGTCAGG - Exonic
935375611 2:102393733-102393755 GAGAAAGAAGGAAAGTAGTGGGG - Intronic
935960692 2:108423094-108423116 CAGAAAGAATGGAAGGAGGCAGG - Intergenic
937856327 2:126674367-126674389 CAGAAAGTAAGGAAGTTTTCTGG - Intronic
939129284 2:138214742-138214764 CAGAAAATCAGGAAGTAGCCAGG - Intergenic
941424759 2:165328516-165328538 CAGGAAGTAGAGAAGGAGACAGG + Intronic
941621732 2:167786772-167786794 CAGAAAGTACTGAAGTAAGCAGG + Intergenic
941963570 2:171277609-171277631 CAGAAAATGGCGAAGTTGTCAGG + Intergenic
942677971 2:178448812-178448834 GAGAAAGACGGGAAGTAGTTAGG + Intronic
942848926 2:180459580-180459602 CAGAAAGTAGGTAAATAGAAAGG - Intergenic
943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG + Intergenic
943719710 2:191191073-191191095 CAGAAAAAAGGGAAGTCTTCAGG + Intergenic
944151600 2:196564460-196564482 CAGGAAGTGTGGAAGTATTCAGG + Intronic
944968275 2:204961256-204961278 TAGAAACAAGGGAACTAGTCAGG + Intronic
945194171 2:207222951-207222973 GAGACAGAAGGGAAGAAGTCAGG + Intergenic
946865004 2:224034802-224034824 GAGGAAGTGGGGCAGTAGTCAGG + Intronic
948939044 2:241187198-241187220 CAGAAACCAGGAAAGGAGTCGGG - Intergenic
1168749295 20:270944-270966 CAGAAAGAAGGGAAGAAGAGAGG + Exonic
1168791345 20:578413-578435 CAGCAAGTAGGGAGCTAGGCTGG - Intergenic
1169899009 20:10534265-10534287 CAGAAAGAAAGGAAGGAGGCAGG - Intronic
1170727313 20:18941556-18941578 AAGAATCTAGGGAAGCAGTCTGG + Intergenic
1171179581 20:23082792-23082814 CACCAAGTAGGGAGCTAGTCAGG - Exonic
1173703338 20:45092474-45092496 CAGAAAATATGGAAGCCGTCGGG + Exonic
1174383409 20:50172014-50172036 CAGAAAGGAGGGCAGAAGTGAGG - Intergenic
1174776155 20:53345087-53345109 CAGACAGAAGGGAAGTGGTCAGG + Intronic
1177745242 21:25204761-25204783 CAGAAAGAAAGAAAGTAGTGAGG + Intergenic
1178461129 21:32803337-32803359 CAGAAAGTATGGGAGGAGTGTGG + Intronic
1179294402 21:40048113-40048135 CAGAGACTAGGGGATTAGTCAGG - Intronic
1180993144 22:19950708-19950730 GAGAAAGTAGGGAAGTATGGAGG + Intronic
1181554392 22:23659677-23659699 TAGTAAGTAGGAAAGCAGTCAGG - Intergenic
1181823886 22:25497560-25497582 AAGAAAGTAGGGAGAGAGTCAGG + Intergenic
1182242132 22:28924451-28924473 CAAAAAGTAGGTAAGCAGCCAGG + Intronic
1182332396 22:29560540-29560562 TAGAAAATAGGCAAGGAGTCTGG - Intronic
1183836769 22:40460815-40460837 CATAATGTAGGTAAATAGTCTGG + Intronic
1184881527 22:47307473-47307495 CAGCAAGAAGGGAAGGAGGCTGG - Intergenic
950116181 3:10451445-10451467 CAGTAAACTGGGAAGTAGTCAGG - Intronic
950650460 3:14403711-14403733 CAGAAGGAAGAGAAATAGTCTGG - Intronic
950677326 3:14562282-14562304 CAGAAAGTAAGGAAGTGTTCAGG + Intergenic
951532889 3:23714237-23714259 CAGAAAATAGGGCTGTAGTGAGG + Intergenic
955594519 3:60574237-60574259 CAGAAAGTGAGAAAGAAGTCAGG - Intronic
956731133 3:72197734-72197756 CAAAAAGGAGGGAAGAAGTGAGG - Intergenic
956764965 3:72477153-72477175 CAGGCAGTAGGAAAGAAGTCAGG + Intergenic
960084818 3:113579122-113579144 CAGAAACTGGGGAGGTAGCCAGG + Intronic
960532616 3:118781954-118781976 CAGCAAGTATGGAAGCTGTCAGG + Intergenic
962884798 3:139614324-139614346 CAGAAAGTAGGGAAGTAGTCAGG - Intronic
963583725 3:147158492-147158514 TAGAAAGAAGGGAAGAAGGCAGG + Intergenic
963643329 3:147883599-147883621 CACAAAGAAGTGAAGCAGTCAGG - Intergenic
966018606 3:175177193-175177215 GAGATAGCAGGGAAGTAGTAAGG - Intronic
967458852 3:189721998-189722020 AAGAAAGTAGAGAAGTAGGAAGG + Intronic
967503715 3:190229230-190229252 CAGAAAGTGGGTAAGTAGGAAGG + Intergenic
967778628 3:193411677-193411699 CAGAATGTAAGGAAGTAGGAGGG + Intronic
968278687 3:197459494-197459516 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278700 3:197459554-197459576 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278707 3:197459584-197459606 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278714 3:197459614-197459636 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278721 3:197459644-197459666 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278728 3:197459674-197459696 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278736 3:197459705-197459727 CAGTTAGTAGGGATGTGGTCGGG + Intergenic
968278776 3:197459859-197459881 CAGTTAGTAGGGATGTGGTCAGG + Intergenic
968278826 3:197460059-197460081 CAGTTAGTAGGGATGTGGTCAGG + Intergenic
970191307 4:13522315-13522337 AGGAAGGTAGGGAAGTTGTCAGG - Intergenic
970587193 4:17526026-17526048 CAAAACATAGGGAAGTAGTTTGG + Intronic
976006016 4:80431465-80431487 CGGAAAGAAGGGAAGGAGTGAGG - Intronic
976125110 4:81826055-81826077 CTGAAAGAAGGGAAGAATTCTGG + Intronic
977858829 4:101930534-101930556 CAGATAGTAGTTAAGTACTCTGG + Intronic
978210445 4:106129737-106129759 CAAAAAGTAGGTAAGTATTCTGG + Intronic
979478346 4:121184581-121184603 CTGAAAGTTGGAAGGTAGTCAGG - Intronic
980502377 4:133673093-133673115 CAAAAATTAAGGAAGTGGTCGGG - Intergenic
980788252 4:137582460-137582482 GAGAAAGTAGGGAAAGAGACAGG + Intergenic
982322394 4:154092590-154092612 CAGAAAGTAGGGAAGAATATAGG - Intergenic
985753667 5:1699776-1699798 CAGAAATTATGGAAGTCGTGGGG - Intergenic
987711187 5:21501993-21502015 TAGGAAGTAGGAAAGCAGTCAGG + Intergenic
988748958 5:34175633-34175655 TAGGAAGTAGGAAAGGAGTCAGG - Intergenic
990316181 5:54585339-54585361 CAGAAAGCAGGGAGTTTGTCGGG - Intergenic
991761532 5:69921034-69921056 TAGGAAGTAGGAAAGCAGTCAGG + Intergenic
991785797 5:70197066-70197088 TAGGAAGTAGGAAAGCAGTCAGG - Intergenic
991840760 5:70796083-70796105 TAGGAAGTAGGAAAGCAGTCAGG + Intergenic
991878242 5:71197457-71197479 TAGGAAGTAGGAAAGCAGTCAGG - Intergenic
992998632 5:82357501-82357523 CGGAAACAAGGGAAATAGTCTGG + Intronic
993080493 5:83291687-83291709 GATAAAGTCGGTAAGTAGTCAGG - Intronic
994715398 5:103315549-103315571 CAGAAAGTAGAGAAGTAGTAAGG + Intergenic
995023214 5:107389880-107389902 CAGAAAATGAGGAAGTAGTGGGG - Intronic
995305234 5:110639130-110639152 GAGTAAGTAGGGAGGTAGCCAGG + Intronic
996992362 5:129650508-129650530 CAGAAAATAAGGAGGTAATCTGG - Intronic
997045683 5:130313827-130313849 GAGAAAGTAAGAAAGCAGTCAGG - Intergenic
997468467 5:134103559-134103581 CAGAAAGTCTCGAAGTACTCAGG - Intergenic
998941665 5:147290256-147290278 GAGAAAGAAGGTAAGTAGTCTGG + Intronic
1000207423 5:159075772-159075794 CAGAAGGTTGGGAGGTGGTCTGG - Intronic
1001209492 5:169796744-169796766 CAGCTAGAAGGGAAGGAGTCAGG + Intronic
1001220459 5:169895905-169895927 CAGAAAATAGGGAAGAAGGAAGG - Intronic
1001711947 5:173786176-173786198 CAGAAAGGAGAGACGTAGGCCGG + Intergenic
1003855925 6:10274744-10274766 GAGAAAGTTGGGAAGTTTTCAGG - Intergenic
1004363611 6:14993286-14993308 CAGAAAGTAGGATGGTGGTCAGG + Intergenic
1005415308 6:25593931-25593953 CAGCAAGAAAGAAAGTAGTCAGG + Intronic
1007543585 6:42672785-42672807 AAGAAAGTGGGGAAGGAGGCAGG - Intronic
1007695221 6:43727903-43727925 CTGAAAGTAAGGAAGGGGTCTGG + Intergenic
1009017256 6:57919595-57919617 TAGGAAGTAGGAAAGCAGTCAGG - Intergenic
1010145612 6:72665633-72665655 TGGAAAGAAAGGAAGTAGTCTGG - Intronic
1011907656 6:92392306-92392328 CAGAATGTAGGGATGGAGTGGGG - Intergenic
1012050756 6:94341166-94341188 CAGAAAGAAGGAAATTAGTCTGG - Intergenic
1012629135 6:101441892-101441914 CAGAACATAAGAAAGTAGTCTGG + Intronic
1015430359 6:133123586-133123608 CAGGAAGCAGGCAAGGAGTCAGG - Intergenic
1015535154 6:134260055-134260077 TAGAAAGTAGACAAGTAGGCTGG + Intronic
1015800021 6:137051280-137051302 CAGAAAGTAAGGAAGTGCTCAGG - Intergenic
1020514239 7:9096305-9096327 AAGAAAGTATGGTAATAGTCTGG - Intergenic
1021191949 7:17631083-17631105 CAAAAAGTGGGGAACTAGTATGG - Intergenic
1021725877 7:23547770-23547792 CAGAAAGCAAGGAAGCAGACAGG - Intergenic
1022582438 7:31569296-31569318 CAGGAAGTTGTGAAGTAGTGTGG - Intronic
1023329316 7:39097963-39097985 CAAAAAGTAGGGAAGAAGAAAGG + Intronic
1028158481 7:87459020-87459042 AAGAAAGTTGGGAATTATTCTGG + Intronic
1030114589 7:106053674-106053696 CAGAAAGAAGGGAAGGAGGGAGG - Intergenic
1030676953 7:112394201-112394223 AAGAAAGAAGGGAAGCAGGCAGG - Intergenic
1031089001 7:117330213-117330235 CAGAAAGTACTTAGGTAGTCAGG + Intergenic
1031519102 7:122741305-122741327 CAGAAACTAGGGAAGAAGGATGG + Intronic
1031981745 7:128131573-128131595 CAGAAAGTAGGGAAGGGCTCAGG + Intergenic
1033600637 7:142886029-142886051 GAGAAAGGAGGGGAGGAGTCAGG + Intergenic
1033644749 7:143292568-143292590 CAGACCTTAGGGAAGTGGTCCGG - Intronic
1034309615 7:150075484-150075506 CACAAAGGAGGGAAATAATCAGG + Intergenic
1034419461 7:150981413-150981435 TAGAAAGAAGGGAAGTAGGAAGG + Intergenic
1034797244 7:154025157-154025179 CACAAAGGAGGGAAATAATCAGG - Intronic
1037052561 8:14394443-14394465 TAGAAGGTAGGGAAGTGGGCTGG - Intronic
1038272838 8:26090087-26090109 GAGAAAGTAAGAAACTAGTCAGG + Intergenic
1038460627 8:27713670-27713692 CAGAAAGTAAGGAAGTGTCCAGG - Intergenic
1038629322 8:29226144-29226166 CAGGAAGTTGGGAATTACTCAGG - Intronic
1039314537 8:36356738-36356760 GAGAAAGAAGGGAAGGAGGCAGG + Intergenic
1041903435 8:63007317-63007339 GAGGAAGTGAGGAAGTAGTCAGG + Intergenic
1042247053 8:66718319-66718341 TAGAAAATAGGGAGGTAGGCTGG - Intronic
1043156539 8:76788174-76788196 CAGGAAGTAAGGAAGAAGTAAGG - Intronic
1043841799 8:85114410-85114432 CCGAAAGTAAGAAAGAAGTCTGG - Intronic
1043943597 8:86225021-86225043 CAAAAAATAGGGAAGCAGACTGG - Intronic
1045389495 8:101701329-101701351 AATAAAGTAGGGAAGTAGCCTGG - Intronic
1048157484 8:131972302-131972324 CAGAAAGTACAGAATTCGTCTGG - Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1051080560 9:13288881-13288903 TAGAAAGGAGGGAAGTTGGCAGG - Intergenic
1055778140 9:79788775-79788797 CAGAAATGAGGGAAGCTGTCAGG + Intergenic
1057737421 9:97677382-97677404 CAGAAAGTAAGAAAGTATTCGGG + Intronic
1058842263 9:108921284-108921306 CAGAAAGTAGAGTAGTGGTTGGG - Intronic
1061690336 9:132322404-132322426 CAGAAAGATGAGTAGTAGTCAGG - Intronic
1186985502 X:15009457-15009479 GAGAAAGTAGGGAGTTATTCAGG + Intergenic
1190286104 X:48962410-48962432 CACATAGTGGGGAAGTAGCCAGG - Exonic
1192908389 X:75577670-75577692 CAGGAAGTAGAGAAATAGACAGG - Intergenic
1193943229 X:87702666-87702688 CAGGAAGTAGGGAAGCTTTCTGG + Intergenic
1194879375 X:99231879-99231901 CAGTCAGAAGGGAAGTATTCTGG - Intergenic
1196519557 X:116657119-116657141 CAGAAAAGAGGGAAGGAATCTGG + Intergenic
1197515736 X:127426072-127426094 AAGAAAGTAGGGAAGGGGACAGG + Intergenic
1201435992 Y:13959085-13959107 CAGAATGAAGGGAAGAAATCTGG + Intergenic