ID: 962885942

View in Genome Browser
Species Human (GRCh38)
Location 3:139627893-139627915
Sequence GTTTAAGGAGGGTTGGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962885937_962885942 -10 Left 962885937 3:139627880-139627902 CCATTAAAACAACGTTTAAGGAG 0: 1
1: 0
2: 6
3: 25
4: 155
Right 962885942 3:139627893-139627915 GTTTAAGGAGGGTTGGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 75
962885933_962885942 24 Left 962885933 3:139627846-139627868 CCATTACTTCTCACTTGTAAGAT 0: 1
1: 0
2: 1
3: 22
4: 279
Right 962885942 3:139627893-139627915 GTTTAAGGAGGGTTGGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962885942 Original CRISPR GTTTAAGGAGGGTTGGCCAT GGG Intronic
902157793 1:14503669-14503691 GGGTTAGGAGGGTTGGACATGGG - Intergenic
907077497 1:51591963-51591985 GATTGAGGAGGGTTGGCTACGGG - Intronic
907352991 1:53848853-53848875 GGTAAAAGAGGGTTGGCCAGTGG - Intergenic
911328832 1:96501808-96501830 TTTTTAGGAAGTTTGGCCATAGG - Intergenic
1067276866 10:44843618-44843640 GTCTAAGGAGGGGTGGAGATAGG + Intergenic
1072575306 10:96694301-96694323 GTTTATGGAGTGTCTGCCATGGG - Intronic
1079283133 11:19105908-19105930 TTTTAAGGAGGCTTGGACACTGG + Intergenic
1081446082 11:43132789-43132811 ATTTATTGAGGGTTGGCCAGGGG - Intergenic
1081620272 11:44615197-44615219 GTTTAAGTAGGGGTGACCACAGG + Intronic
1083197097 11:61094844-61094866 ATTAGAGGTGGGTTGGCCATCGG + Intergenic
1085410822 11:76289308-76289330 GTTTGAGGATGGATGGGCATGGG - Intergenic
1087756906 11:102063967-102063989 GTAGAAGGAGGGATGGTCATGGG - Intronic
1091396596 12:157231-157253 CTATCAGGAGGGTTGGACATTGG + Intronic
1092915322 12:13184255-13184277 GTTTAAGCATGGCTGGCCATTGG + Intergenic
1097341435 12:58442895-58442917 GTTTAAAGAGTGAAGGCCATAGG + Intergenic
1098358075 12:69629759-69629781 GTATAAAAAGGGTTAGCCATCGG - Intergenic
1098843591 12:75508297-75508319 CTTGAAAGAGTGTTGGCCATTGG - Exonic
1098978185 12:76926585-76926607 ATTTAAGGAGGGCTGGAGATTGG + Intergenic
1101205616 12:102484091-102484113 TTGTGAGGAGGGTTGGTCATGGG + Intergenic
1103320490 12:120090137-120090159 GTGTAAGGAGAGTTTGCCACTGG + Intronic
1107423954 13:40274879-40274901 GTGGCAGGAGGGCTGGCCATTGG - Intergenic
1111744385 13:92248242-92248264 GATTAAGGAGGGCTGGCTACAGG + Intronic
1120192648 14:81453061-81453083 GTTTAAGGAAGGCAGGGCATGGG + Intergenic
1126230428 15:46317015-46317037 CCTTAAGTAGGGTTGGCCTTGGG - Intergenic
1129890270 15:79067134-79067156 GTTTATGGAGGGGTGGCCTTCGG + Intronic
1130683120 15:86013886-86013908 CTTTAAGGAGGGTAGGCTTTGGG - Intergenic
1131055891 15:89374746-89374768 GTTTACTGAGGAATGGCCATGGG + Intergenic
1133550361 16:6848458-6848480 GTCTAAGGTGGGCTGGCAATCGG - Intronic
1134902100 16:17947696-17947718 GTATCAGGATGGATGGCCATAGG + Intergenic
1138424879 16:56924731-56924753 GTTAAGGGAGGGTTTGCCTTGGG + Intergenic
1140453375 16:75089570-75089592 GGGTAGGGAGAGTTGGCCATAGG - Intronic
1143497458 17:7320691-7320713 TTTTCAGGGGGGTTGGCCATGGG + Intronic
1143979967 17:10860446-10860468 GTGCAAAGAGGTTTGGCCATTGG + Intergenic
1144788206 17:17843418-17843440 ATTTAAGCAGGGGTGGCCATGGG - Intergenic
1151597325 17:75086538-75086560 TTTTAAGCAGGGTTGGCAGTAGG + Intergenic
1153600705 18:6778581-6778603 GATTAAAGAGGGTTTGCCACTGG - Intronic
1165394456 19:35556821-35556843 GTTTCAGGTGGGTTTGTCATGGG + Intronic
1166750079 19:45160369-45160391 GGATAAGGAGGGATGGCCAGAGG + Intronic
928717902 2:34084146-34084168 GATTATGCAGGGTTGGCTATAGG - Intergenic
929868804 2:45740551-45740573 GTTTGAGGAGGGCTTGCAATGGG - Intronic
931787671 2:65635024-65635046 GTCTAAGGAGGGTTGTTGATTGG + Intergenic
935089273 2:99878750-99878772 GTAAAAGGAGGGTTGGCTAGGGG + Intronic
937615454 2:123916693-123916715 TTATAAGCAAGGTTGGCCATGGG - Intergenic
939601576 2:144198610-144198632 GTTTTAGGGTGGTTGGCTATTGG - Intronic
946267699 2:218561963-218561985 AATTAAGGAGGGTTGGGGATGGG - Intronic
947186340 2:227458923-227458945 ATTTAAGGAGGATGGGCCAGAGG - Intergenic
948633658 2:239319232-239319254 CTTTAAGGAGCAGTGGCCATAGG + Intronic
1171392822 20:24812109-24812131 GTGTCAGGAGGGTTGGGTATGGG - Intergenic
1179607577 21:42527246-42527268 GTGTAAGGTGGGCTGGCCTTTGG + Intronic
950555082 3:13690464-13690486 GTTCAAGGAGGCTTGGCCAAGGG - Intergenic
953198016 3:40752228-40752250 GTTTTAGGAGGCTCGGCCGTTGG + Intergenic
954072115 3:48150661-48150683 TTTTTAGGAGGGTTGGGGATGGG - Intergenic
954508275 3:51097899-51097921 GCTGAAGCAGGGTTGGGCATTGG - Intronic
962885942 3:139627893-139627915 GTTTAAGGAGGGTTGGCCATGGG + Intronic
964892353 3:161552349-161552371 GTTTAAGGAGGGATGGCAAAGGG - Intergenic
969929515 4:10616880-10616902 CTTTAAGGTGGGTTAGCCAGTGG - Intronic
976206783 4:82630176-82630198 TTATAAGGTGGGCTGGCCATAGG + Exonic
977707173 4:100085177-100085199 AGATAAGGAGGGTAGGCCATGGG + Intergenic
978788540 4:112637039-112637061 GTTCCAGGAGGGCTGGGCATCGG - Intronic
987225187 5:15832571-15832593 GTTTAAGGAGGTTTTGCAAGTGG + Intronic
990596458 5:57317000-57317022 GTGTATGGAGGGTTAGCCAATGG + Intergenic
990953198 5:61318863-61318885 GTTTGAGGAGGGCTGGCAACAGG - Intergenic
1001434316 5:171687386-171687408 GCTTGAGGAGGGTTTGCCAGGGG - Intergenic
1003417613 6:5926518-5926540 GTTTTAGGAGGTGTGGCCCTTGG - Intergenic
1005027042 6:21473194-21473216 GTTCCAGGAGGGTTGGATATGGG + Intergenic
1006342246 6:33453055-33453077 GTTTGGGGTGGGTAGGCCATGGG + Exonic
1010081630 6:71870649-71870671 GGTTAACCAGGGTTGGACATAGG + Intergenic
1016624332 6:146148037-146148059 CTTTAAGTAAAGTTGGCCATAGG - Intronic
1022473871 7:30698003-30698025 GTTTAAGGAGGACTGCCCATGGG - Intronic
1030338720 7:108353096-108353118 GTATGATCAGGGTTGGCCATGGG - Intronic
1046100613 8:109610089-109610111 GCTTAAGGAGGGTTGGGGATGGG - Intronic
1047958828 8:129996216-129996238 GGTTAAGGAGGGCTTCCCATAGG - Intronic
1050201775 9:3152403-3152425 TTTAAAGGAGGGTTGGACTTTGG - Intergenic
1050518842 9:6476004-6476026 GATAAAGAAGGGTTGGCTATAGG - Intronic
1055416685 9:76091620-76091642 TTTTAATGAGGTTTGGCCAGTGG + Intronic
1057580931 9:96287216-96287238 GTTTCAGCTGGGTTGGCCAGTGG - Intronic
1058893145 9:109378568-109378590 GCTTCTGGAGGGTTGGCCGTGGG - Exonic
1061258582 9:129466978-129467000 GGTCAAAGAGGGTGGGCCATGGG + Intergenic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1188682716 X:33031249-33031271 GTTTATTGAGGGTTGCCCCTGGG - Intronic
1189298912 X:39937986-39938008 CTTTGAGGAGGGCTGGCCAGGGG - Intergenic
1192227924 X:69242108-69242130 GTATAAGGAGAGTGGGCCATTGG - Intergenic
1193300961 X:79887727-79887749 GTTTCAGGAAGGTTGTCTATAGG - Intergenic
1194566640 X:95496680-95496702 GTTTAATGCTGTTTGGCCATGGG - Intergenic
1197247721 X:124183415-124183437 GTTAAAGTACTGTTGGCCATGGG + Intronic