ID: 962892065

View in Genome Browser
Species Human (GRCh38)
Location 3:139680565-139680587
Sequence CACCCAAGGCTGCAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962892056_962892065 29 Left 962892056 3:139680513-139680535 CCTAGGGGAAAACCCTAGAAAAC 0: 1
1: 0
2: 85
3: 68
4: 199
Right 962892065 3:139680565-139680587 CACCCAAGGCTGCAGGAGACAGG 0: 1
1: 0
2: 5
3: 21
4: 290
962892057_962892065 17 Left 962892057 3:139680525-139680547 CCCTAGAAAACTGTGTGAAGAGC 0: 1
1: 0
2: 0
3: 23
4: 170
Right 962892065 3:139680565-139680587 CACCCAAGGCTGCAGGAGACAGG 0: 1
1: 0
2: 5
3: 21
4: 290
962892060_962892065 -9 Left 962892060 3:139680551-139680573 CCTTGGAATCATCCCACCCAAGG 0: 1
1: 2
2: 2
3: 21
4: 166
Right 962892065 3:139680565-139680587 CACCCAAGGCTGCAGGAGACAGG 0: 1
1: 0
2: 5
3: 21
4: 290
962892058_962892065 16 Left 962892058 3:139680526-139680548 CCTAGAAAACTGTGTGAAGAGCA 0: 1
1: 0
2: 3
3: 34
4: 200
Right 962892065 3:139680565-139680587 CACCCAAGGCTGCAGGAGACAGG 0: 1
1: 0
2: 5
3: 21
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962892065 Original CRISPR CACCCAAGGCTGCAGGAGAC AGG Intergenic
900323332 1:2095636-2095658 CATGCCAGGCTGCGGGAGACAGG - Intronic
900988558 1:6087073-6087095 GAGCCAAGGCTGGAGGAGGCCGG - Intronic
901220738 1:7582367-7582389 CACCCAAGGATGCAGGGTAGGGG - Intronic
901496694 1:9626467-9626489 CCCCCAAGGCTGCTGGAGAGGGG + Intergenic
901678185 1:10898778-10898800 CTGCCAAGGGTGCAGCAGACAGG + Intergenic
904037268 1:27565491-27565513 CACCCAACCCTTAAGGAGACAGG + Intronic
904848650 1:33440326-33440348 CACCCAAGGATTGAGGAAACGGG - Intergenic
905006331 1:34713083-34713105 CAGCCAAGGCTGCAGGACTAGGG + Intronic
905873271 1:41416803-41416825 CCCTGAAGGCTGCAGGAGACAGG - Intergenic
906545813 1:46618700-46618722 AACCCCAGGCTGCAGGAGTGTGG + Intergenic
907185881 1:52608723-52608745 CACCCAAGGCTTCTGTAAACTGG + Exonic
908262992 1:62353270-62353292 CAGCCAGGGCTGGAGGAGAGGGG + Intergenic
913411957 1:118561961-118561983 CACCAGAGGCTGGAGGAGGCAGG + Intergenic
915588939 1:156859919-156859941 CACCCAGGGCAGCAGAAGGCTGG - Intronic
915896309 1:159813750-159813772 GAGCCAGGGCTGCAGGAGACGGG + Intronic
916452688 1:164936125-164936147 CACCCAAGGCTCTCGGAGATGGG + Intergenic
918180725 1:182084371-182084393 AACCCAAGGAAGCAGGAGGCAGG - Intergenic
921937307 1:220806951-220806973 CACCCAACGCTGTTGGAGCCAGG - Intronic
922985737 1:229864868-229864890 GCTCCAAGGCTGCAGGAGGCGGG + Intergenic
923034990 1:230279482-230279504 CACCCAATGGTGCAGGAGACAGG - Exonic
924608976 1:245558273-245558295 AGCCCAAGGCTGCAGGGGGCTGG + Intronic
1063135732 10:3214567-3214589 CAGCCATGGCTGCAGGGGCCAGG - Intergenic
1063207957 10:3853091-3853113 CACCCAGGTCTGCAGGAGGGTGG + Intergenic
1063995187 10:11611851-11611873 CGCCCAGGGCTGCAGGTGCCCGG + Intergenic
1064101883 10:12471189-12471211 CACTGCAGGCTGCAGGAAACAGG + Intronic
1066049464 10:31620580-31620602 CACCCAAGGCTGGGGGTGACAGG - Intergenic
1066080206 10:31923089-31923111 CACCCCAGGCTGCAGTACAGTGG - Intronic
1068668549 10:59701201-59701223 GACCCTAGGATGCTGGAGACGGG - Intronic
1069462026 10:68604585-68604607 CAATCAAAGCAGCAGGAGACTGG - Intronic
1069591277 10:69643886-69643908 CAGCCAGGGCTGCAGGAGGGGGG - Intergenic
1069604331 10:69730307-69730329 CACTCAAGGCTGGTGGGGACAGG - Intergenic
1069614173 10:69796307-69796329 CACCCAAAGGTGCAGAAAACAGG + Intergenic
1070747562 10:78943762-78943784 CACCCAAGGATGGAGGAGGTTGG + Intergenic
1072318339 10:94224863-94224885 TACTCATAGCTGCAGGAGACGGG + Intronic
1072620249 10:97074837-97074859 CTCCCAGGGCTGGAGGAGGCAGG + Intronic
1073494575 10:103879659-103879681 GACCGAAGGCTGTAGGAGAGTGG + Intergenic
1075442579 10:122491715-122491737 CTCCCAAGACAGCAGGAGTCAGG - Intronic
1075723504 10:124600349-124600371 CACAGAGGGCTGCAGGCGACTGG + Intronic
1076800719 10:132826822-132826844 CACCCCAGGCTGCAGGATTTTGG + Intronic
1076886960 10:133267409-133267431 GACCGGAGGCTGGAGGAGACAGG + Exonic
1077337399 11:2011559-2011581 GCCACAAGGCTGCAGGAGCCTGG + Intergenic
1077373576 11:2194968-2194990 CACCCCAGGCAGCAAGAGAGAGG - Intergenic
1077446335 11:2592737-2592759 CGCCCAAGGCAGCAGCAGCCGGG - Intronic
1078955989 11:16195850-16195872 CACCCGGGGCAGCAGGACACTGG - Intronic
1080388422 11:31823742-31823764 CTCCCTGGCCTGCAGGAGACTGG - Intronic
1080401205 11:31937617-31937639 CTCACAAGGCAGCAGGAGAGAGG + Intronic
1080628746 11:34053079-34053101 ACCCCAAGGCTGCAGGACGCAGG - Intronic
1080750371 11:35145177-35145199 CCCCCAGTGCTGCAGAAGACAGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083169520 11:60914593-60914615 GAGCCGAGGCTGCAGGAGGCTGG - Intronic
1083171486 11:60926048-60926070 CACCCAGGGTTGCAAAAGACAGG + Intronic
1083379657 11:62254959-62254981 CAACCTCAGCTGCAGGAGACAGG - Intergenic
1083727235 11:64634936-64634958 CTCCGAAGGCTACAGGAGAATGG + Intronic
1084312824 11:68326650-68326672 CACAGCAGGCTGCAGGAGAGAGG - Intronic
1084421319 11:69062098-69062120 CACTCATGGCAGAAGGAGACGGG + Intronic
1084506132 11:69569689-69569711 CTCCCAAGGCCACAGGAGAGTGG - Intergenic
1084531534 11:69730643-69730665 CGCCTAATGCTGCAGGAGAGAGG + Intergenic
1084670679 11:70604901-70604923 CACACAAGGGTGCTGGACACAGG + Intronic
1084680208 11:70662472-70662494 CTTCCAAGGCTGCAAGGGACCGG - Intronic
1085507947 11:77070798-77070820 CACCGGAGGCTGGAAGAGACAGG - Intronic
1085561916 11:77479513-77479535 CACTCAAGGCAGCAGGAAACAGG - Intergenic
1087332194 11:96794175-96794197 CACCCAAGGAGACAGGAGAGAGG - Intergenic
1088117315 11:106327290-106327312 AACCCAGGGCTACTGGAGACAGG - Intergenic
1089645563 11:119876399-119876421 CACCCCAGCCAGCAGGACACAGG - Intergenic
1090266882 11:125358952-125358974 CTCCCCAGGCCGCAGAAGACTGG - Intronic
1090754242 11:129774757-129774779 CACCCAAGGCTGGAGTGGAGTGG + Intergenic
1202820383 11_KI270721v1_random:66741-66763 GCCACAAGGCTGCAGGAGCCTGG + Intergenic
1091627113 12:2129851-2129873 TTCCCAAGCCTGCAGGAGAGAGG - Intronic
1092981259 12:13796718-13796740 CTCCCAAGCCTGCAGGGGAATGG - Intronic
1093100452 12:15022297-15022319 CTCCCAAAGCTGTAGGATACAGG - Intergenic
1093370148 12:18355680-18355702 CACCCAAGCCTGGAGGGGAGGGG + Intronic
1096002078 12:48138515-48138537 CAAGCAAGGCTGCAGGTAACTGG - Intronic
1098887724 12:75977233-75977255 CACCCAAGGCTGGAGGCCAGTGG + Intergenic
1099226929 12:79980962-79980984 CACCCAAGGCTGGAGTACAGTGG + Intergenic
1101245005 12:102876811-102876833 CCCCCATGGCTGCAAGACACAGG + Intronic
1102525548 12:113510100-113510122 CACCCCAGGATGGAGGAGGCAGG - Intergenic
1103443479 12:120979738-120979760 CACCCAGTTCTCCAGGAGACGGG - Intronic
1110551328 13:76814117-76814139 CTGCCCAGGCTGCAGGAGAGAGG - Intergenic
1110570031 13:76992785-76992807 TAACCAGGACTGCAGGAGACGGG - Intronic
1110626692 13:77661664-77661686 CACCCAAAGCTGCCGGCCACAGG - Intergenic
1113695969 13:112345702-112345724 CCCCCAAGGCTGCAGTCGAGGGG + Intergenic
1113960439 13:114122888-114122910 CAGCCAACGCTGCATGAGAAAGG + Intronic
1114547805 14:23515032-23515054 CACCCAAGGCTCCAGGCTAGTGG + Intergenic
1114626208 14:24131837-24131859 CACTCAAGGCTGTGGGAGCCGGG + Intronic
1117305919 14:54472991-54473013 CAGCCAAGGCTGCATGATTCTGG + Intergenic
1117733960 14:58751092-58751114 CAGCCAAGGCAGCAGGGGGCTGG - Intergenic
1117843707 14:59888676-59888698 CACCCAAAGAAGCAGGAGAAGGG + Intergenic
1118596051 14:67436485-67436507 CATGCAAGGCTGCAGAAGACTGG - Intergenic
1118682974 14:68262351-68262373 CTCCCAAGGTAGCAGGTGACAGG - Intronic
1120512387 14:85431058-85431080 TTCACAAGGCTGCAGGAGAGAGG + Intergenic
1121054701 14:90843117-90843139 TTCCTAAGGCTGCAGAAGACTGG - Intergenic
1122406663 14:101504903-101504925 AGCCCAAGGCTGCAGGCGGCTGG + Intergenic
1122437508 14:101710083-101710105 CAGCTGAGGCTGCAGGAGAGAGG + Intergenic
1122862769 14:104589945-104589967 CTCCCAGGCCTGCAGGAGATGGG - Intronic
1123630073 15:22255052-22255074 TACCAGAGGCTGCAAGAGACAGG - Intergenic
1125209455 15:37196491-37196513 TACCAAAGGCTGCAGGAGGTGGG - Intergenic
1126150860 15:45522681-45522703 CACCCGCGGCCGCAGGAGAGTGG + Exonic
1128506150 15:68274300-68274322 AAACCAAGGCTGGAGGAGAGGGG - Intergenic
1130073675 15:80670671-80670693 CACCCAGCGATACAGGAGACAGG + Intergenic
1130988324 15:88859148-88859170 CTCCCACGGCTTCTGGAGACAGG + Exonic
1131157496 15:90084233-90084255 CACCCATGGCTGCAGTGGAGGGG - Exonic
1131360642 15:91787750-91787772 CACCAAAAGCTACAGAAGACAGG - Intergenic
1131397312 15:92097005-92097027 CACCCAAGGCAGCACAAGACAGG + Intronic
1131716674 15:95119071-95119093 AACCCAAGTCTGTTGGAGACAGG - Intergenic
1132135884 15:99338092-99338114 CAAGGAAGGCTTCAGGAGACTGG + Intronic
1133100157 16:3474569-3474591 CACCCATGGCAGCAGGAGGGCGG + Intronic
1133243879 16:4433605-4433627 TACCCAAGGCTGCAAGATAGAGG + Intronic
1134224989 16:12382748-12382770 CACCCGAGGCTAGAAGAGACAGG - Intronic
1134827525 16:17296509-17296531 CAGCCAAGGCCCCAGGGGACAGG + Intronic
1136059285 16:27714016-27714038 GGCCCAAGGCTGCTGGAGCCTGG - Intronic
1136484452 16:30562279-30562301 CAGCAAAGGCTGCAGGGGAGGGG + Intergenic
1136621991 16:31435776-31435798 CACCCAGGGCTGCAGCACGCTGG + Exonic
1138958506 16:62001387-62001409 AATCCAAGGCAACAGGAGACCGG + Intronic
1139643630 16:68311240-68311262 CACCCGGGCCTGCAGGAGAGCGG + Exonic
1141973018 16:87495605-87495627 TACCAGAGGCTGCAAGAGACAGG + Intergenic
1142247551 16:88976872-88976894 CCCTCAAGGCTGCAGGAGGTCGG - Exonic
1143370269 17:6435098-6435120 CATCCATGGCTGCAGGAGAAAGG + Exonic
1144599290 17:16598633-16598655 CACTCATGGCGGAAGGAGACGGG - Intergenic
1144738769 17:17569534-17569556 CTCCCAAGGCTGGAGGAAACCGG + Intronic
1144876242 17:18398939-18398961 CACCAAGGGCAGCAGGAGCCTGG - Intergenic
1145155986 17:20545481-20545503 CACCAAGGGCAGCAGGAGCCTGG + Intergenic
1145238925 17:21228261-21228283 CAACCCAGGCTGCTGTAGACAGG - Intergenic
1145264547 17:21373512-21373534 CACCCAAAGCTGGGAGAGACTGG + Intergenic
1146480300 17:33199914-33199936 AACGCAAGGAGGCAGGAGACAGG - Intronic
1146843450 17:36169549-36169571 CACCGATGGCAGCAGGAGCCCGG + Intronic
1146855759 17:36257487-36257509 CACCGATGGCAGCAGGAGCCTGG + Intronic
1146864862 17:36330888-36330910 CACCGATGGCAGCAGGAGCCCGG - Intronic
1146871665 17:36381398-36381420 CACCGATGGCAGCAGGAGCCCGG + Intronic
1146879024 17:36432480-36432502 CACCGATGGCAGCAGGAGCCCGG + Intronic
1146882965 17:36453626-36453648 CACCGATGGCAGCAGGAGCCCGG + Intergenic
1147067721 17:37931482-37931504 CACCGATGGCAGCAGGAGCCCGG - Intronic
1147074551 17:37982022-37982044 CACCGATGGCAGCAGGAGCCCGG + Intronic
1147079252 17:38011037-38011059 CACCGATGGCAGCAGGAGCCCGG - Intronic
1147086074 17:38061561-38061583 CACCGATGGCAGCAGGAGCCCGG + Intronic
1147095191 17:38134979-38135001 CACCGATGGCAGCAGGAGCCCGG - Intergenic
1147102019 17:38185526-38185548 CACCGATGGCAGCAGGAGCCCGG + Intergenic
1147791841 17:43018584-43018606 TACACATGGCTGCAGGTGACAGG - Exonic
1148690647 17:49524995-49525017 CACCCCAGGCTGCAGGAGGCTGG + Intergenic
1148927773 17:51102540-51102562 CACCCAAGGCTGCAGTGCAGTGG + Intronic
1149723585 17:58869538-58869560 CACCCATGGCAGAAGGAGAAGGG - Intronic
1149846610 17:60012036-60012058 CACCGATGGCAGCAGGAGCCCGG + Intergenic
1150084957 17:62268611-62268633 CACCGATGGCGGCAGGAGCCCGG + Intergenic
1150516057 17:65810430-65810452 CACCGATGGCTAGAGGAGACAGG - Intronic
1151574172 17:74943272-74943294 CACCCAGGTCTGAAAGAGACAGG - Exonic
1151968760 17:77446235-77446257 CACCCAAAGCTGGAAGAGGCAGG - Intronic
1152299522 17:79486896-79486918 CTCCCGAGGCAGCACGAGACTGG + Intronic
1152741850 17:82021897-82021919 CACCCAAGGCAGCAGGCGTGGGG - Intronic
1153048759 18:881629-881651 CATCCAAGGCTTCAGGAGATTGG + Intergenic
1153678303 18:7475924-7475946 CAATCAAGGCAGCAGGAAACAGG - Intergenic
1156499337 18:37547262-37547284 CACCCAAGGCTGCTCCAGCCTGG - Intronic
1158408255 18:57179510-57179532 AACCCAAGCCTGAAGGAGACAGG + Intergenic
1160972621 19:1776175-1776197 CATCCCAGGCCGCAGGGGACGGG + Exonic
1161013495 19:1971243-1971265 CACCCAGGGCCCCAGGAGGCCGG + Intronic
1161112467 19:2477837-2477859 GACCCAGGCCAGCAGGAGACAGG + Exonic
1161423859 19:4191295-4191317 CACCCATGACTGCAGGGGCCAGG + Intronic
1161582539 19:5088628-5088650 CCCCTGAGGCTGCAGGGGACAGG + Intronic
1161985146 19:7649052-7649074 CACCCAAGGCTGGAGTGCACTGG - Intergenic
1162327862 19:10009464-10009486 CACCCAAGGCTCCAGCAGCTGGG + Intronic
1162463917 19:10829764-10829786 CACCCAGGCCTGCAGGTGGCAGG + Intronic
1163519353 19:17782808-17782830 CACCCTGGGCTGAAGGAGGCAGG - Intronic
1163637000 19:18441616-18441638 CACCAAAGGCTACAGGAGTGGGG - Intergenic
1163650864 19:18516882-18516904 CACCCATGGCCTCAGGAGGCAGG + Intronic
1164438786 19:28255606-28255628 CAGCCAAAGGTGTAGGAGACAGG + Intergenic
1164802487 19:31089185-31089207 CATCCAAGGCTGAAAGAGAGTGG + Intergenic
1165224189 19:34342523-34342545 CAAGTAAGGCTGCAGCAGACAGG - Intronic
1165753071 19:38273209-38273231 CACCCAAGCCTAGAGGAGATGGG + Intronic
1166356156 19:42228866-42228888 CACCCTGGGCTGCAGGGGCCTGG - Intergenic
1166524877 19:43504586-43504608 CACCCAGGGATCCAGGAGTCGGG + Exonic
1166716038 19:44968543-44968565 CACCCAGGCCTGCAGGAGACTGG - Intronic
1167751849 19:51385584-51385606 CTGCCAGGGATGCAGGAGACAGG - Intronic
925957938 2:8986527-8986549 CACTCTAGGCTGGGGGAGACAGG + Intronic
926706991 2:15843965-15843987 CAGCCAAGGCTGCAAGGGGCAGG + Intergenic
927753065 2:25687023-25687045 CGCCCAAAGCTGCAGGACATGGG - Intergenic
927871994 2:26629586-26629608 CACCCCTTGCAGCAGGAGACAGG - Intronic
932446358 2:71784088-71784110 GACCCAAGGCAGCAGGACAGGGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933719608 2:85389677-85389699 CACACCAGGCTGCAGATGACAGG + Intronic
934651110 2:96091867-96091889 GACCCATGGCTCCAGGAGAGGGG - Intergenic
936151966 2:110026988-110027010 CTCCCAAGGCAGAAGGAGCCTGG + Intergenic
936192712 2:110344425-110344447 CTCCCAAGGCAGAAGGAGCCTGG - Intergenic
937017560 2:118619590-118619612 CACCCAAGCCTGCAGGAAAGTGG - Intergenic
939957975 2:148542516-148542538 AAACAAAGTCTGCAGGAGACTGG + Intergenic
940294777 2:152111082-152111104 CACCCTTGGCTGCAAGAGTCTGG + Intergenic
942073905 2:172339414-172339436 CACCAAGTGCTGCAGGAGGCAGG + Intergenic
943950544 2:194128959-194128981 GGTCCAAGGCTGCAGGAGCCTGG + Intergenic
946249221 2:218402719-218402741 ACCCCAAGGCTGCAGGGCACCGG - Intronic
946388345 2:219399943-219399965 CTCCCAAGGCTGGAGTGGACAGG + Intronic
947163186 2:227235037-227235059 CACCCAAGGGTACAAGATACTGG - Intronic
947857401 2:233333443-233333465 CCCCAAAGGCTGGAGGAGCCTGG + Intronic
948132992 2:235614602-235614624 CACCCAGGCCTGCAGGAGTGTGG + Intronic
948145050 2:235702429-235702451 CTTCCCAGGCTGCAGGAGCCTGG - Intronic
1171190833 20:23158157-23158179 CACCCAGGGCTGCCTGAGAATGG - Intergenic
1172867415 20:38110984-38111006 CACACAAGGCTGCAGGTGGCAGG - Intronic
1173868248 20:46326558-46326580 CACCCAGGGCAAAAGGAGACTGG + Intergenic
1174046866 20:47739998-47740020 CACCCAAGCCTTCAGGGGTCGGG - Intronic
1174885286 20:54327571-54327593 CACCAGAAGCTGCAGGAGGCAGG - Intergenic
1175748510 20:61478304-61478326 CACCCATTGCTGCTAGAGACGGG - Intronic
1175909283 20:62396960-62396982 CACCCAGCGCTGCCTGAGACTGG + Intronic
1175937849 20:62523130-62523152 GACCCAGGGCTGCAGGAGGCAGG - Intergenic
1179391388 21:40995120-40995142 CAGCCAAGGCTGCAAGCCACAGG + Intergenic
1179867944 21:44227963-44227985 GTCCCAAGGGGGCAGGAGACGGG - Intronic
1181520658 22:23447761-23447783 CCCGCGAGGCTGCCGGAGACAGG + Intergenic
1181653460 22:24275104-24275126 CAGACAAGTCTGCAGGAGGCAGG - Intronic
1181906083 22:26197778-26197800 CACCCAAGTCTACTGGAGATTGG - Intronic
1182285888 22:29246703-29246725 CAGGCCAGGCTGAAGGAGACTGG + Intronic
1182622470 22:31625623-31625645 CCCCCGAGGCTGGAGGAGCCTGG - Intronic
1183458189 22:37934033-37934055 CTCCCAACTCTGCAGGAGGCTGG + Intronic
1183541248 22:38430649-38430671 CAGCCAGGGCTCCAGGAGAAAGG + Intronic
1183673956 22:39289629-39289651 CAGCACAGCCTGCAGGAGACAGG - Intergenic
1184479297 22:44737616-44737638 CACCCCAGGCAGGAGGAGACAGG - Exonic
1184673528 22:46027962-46027984 CACCCACGGCAGCCGGAGAGGGG - Intergenic
1184820020 22:46903251-46903273 CATCCCAGGCTGCAGGCGAAGGG + Intronic
1184864754 22:47195891-47195913 CCCCCTGGGCTGCAGGACACAGG + Intergenic
949235293 3:1801883-1801905 CACCCCAGGCTGCAGGGCAGTGG + Intergenic
950454660 3:13085537-13085559 CAGCAGAGCCTGCAGGAGACGGG + Intergenic
953545725 3:43862517-43862539 CTCCCAAGGATGCAGCAGGCAGG + Intergenic
954069303 3:48131177-48131199 AAACTAAGGCTCCAGGAGACTGG - Intergenic
954389070 3:50259560-50259582 GACCCAAGGCTGCAGAGTACTGG - Intergenic
956884902 3:73549396-73549418 AACCTAAGCCTGCAGCAGACAGG - Intronic
958441284 3:94159051-94159073 CACCCAAAGCTTCAGGACCCAGG + Intergenic
959245220 3:103858927-103858949 CAGCAAAGTCAGCAGGAGACTGG - Intergenic
960946436 3:122969987-122970009 CACCCAACTCTGCAGGAAATAGG - Intronic
962395553 3:135012716-135012738 CTCCTACAGCTGCAGGAGACAGG - Intronic
962892065 3:139680565-139680587 CACCCAAGGCTGCAGGAGACAGG + Intergenic
963883694 3:150555792-150555814 GTCCCAAGGCTGCAGGAGTAGGG + Intronic
964848550 3:161069549-161069571 CACCCAGTGCTGCAGGAGACAGG + Exonic
965589104 3:170345662-170345684 CACAGAGGCCTGCAGGAGACTGG + Intergenic
970120330 4:12746272-12746294 AACCAAAGCCTGCAGGAGAGAGG - Intergenic
971586880 4:28415898-28415920 CACCCAAGGCTGGAGTACAGTGG + Intergenic
971841941 4:31863962-31863984 CACAAAAGTCTGCAGTAGACAGG + Intergenic
974013013 4:56624601-56624623 CAGCCAAGGCTGGAGCAGATGGG - Intergenic
978536624 4:109769872-109769894 GACCCAAGGCTGGAGGTGCCTGG - Intronic
981925483 4:150134738-150134760 CACACCAGGCTGCAGAAAACAGG - Intronic
985802157 5:2011704-2011726 CAGCCAGGGCTGCAGGAGGAGGG - Intergenic
986266719 5:6197302-6197324 TGCCCAAGGCTGCAGGGCACTGG - Intergenic
986719294 5:10549633-10549655 CACCAGAGGCTGGAGGAGGCAGG - Intergenic
986963936 5:13247332-13247354 CAGCCAAGGCTGGAGTAGAGTGG - Intergenic
989752804 5:44916014-44916036 CACCCATGGCAGGAGGAGAAAGG - Intergenic
990434335 5:55772762-55772784 CACCCATGGCTGAAGGTGAAAGG - Intronic
995381147 5:111534751-111534773 CACACAAGGCTGCTGTAGGCAGG + Intergenic
998851810 5:146358351-146358373 CACCCAAGGCAGGAGGTGAAGGG + Intergenic
999458945 5:151741118-151741140 GACCCAGGGCTGCTGGAGACTGG - Intergenic
1001274422 5:170339972-170339994 CACTCAGGGCTCCAGGTGACTGG - Intergenic
1001435000 5:171693386-171693408 GCCCCAAGGCTGCAGGGAACAGG - Intergenic
1002055101 5:176594255-176594277 GACTCACTGCTGCAGGAGACAGG - Intronic
1002826857 6:781857-781879 CACACAAGGCTGCAGGGCACAGG - Intergenic
1010029371 6:71257263-71257285 CTCCCAAGGCTGCAGGAGGGAGG + Intergenic
1010599619 6:77807830-77807852 CACCAAAGGCTGCAGAGTACTGG + Intronic
1016000270 6:139034309-139034331 CACCCAGGGCTTCAGGACACAGG + Intronic
1017504375 6:155054131-155054153 CACCCAAGGCTGCAGTGCAGTGG - Intronic
1018936920 6:168279699-168279721 CAGCCTAGGAGGCAGGAGACCGG - Intergenic
1019103125 6:169648204-169648226 CACCCACAGCGGCATGAGACTGG - Intronic
1019153427 6:170023734-170023756 CGCCCCAGGCCGCAGGAAACAGG + Intergenic
1019450808 7:1096855-1096877 CCCCCAAGACTGCAGGTGAGTGG - Intronic
1019590584 7:1828486-1828508 CCCGCGAGGCTGCCGGAGACAGG - Intronic
1019620374 7:1988847-1988869 CGCACCAGGCTGCAGGAGGCAGG + Intronic
1019660998 7:2224001-2224023 AATCCAAGGATGCAGGTGACTGG - Intronic
1020115885 7:5476144-5476166 CACCGACGGCTGCAGGGGAGGGG + Intronic
1021920107 7:25476266-25476288 CACCCAAGGCTACCTGAGCCTGG - Intergenic
1022242788 7:28529226-28529248 CACCCAAGAATGCACGAGAGTGG + Intronic
1022936782 7:35186369-35186391 CACCGAAGGCTGCAGGCGCTGGG - Intergenic
1023626371 7:42119020-42119042 CAGCCAGGGCTGTAGGAGGCAGG + Intronic
1023838581 7:44082638-44082660 CACCCAATCCTGTAGGAGCCCGG - Intergenic
1027052180 7:75027462-75027484 CACCCACGGAGGCAGGACACAGG - Intronic
1027133616 7:75609156-75609178 CCCCCAGAGCTGCAGGAGAAGGG - Intronic
1029649697 7:101882873-101882895 CAGCCAAGGCTGGGCGAGACAGG - Intronic
1032438403 7:131921382-131921404 CACCCAAGTCACCAGGAGATGGG + Intergenic
1033553782 7:142470512-142470534 CCCCCATGGCTGCAGTAGAGAGG - Intergenic
1034449980 7:151132115-151132137 CACCCTGGGCTGCAGGCCACTGG - Intronic
1034670929 7:152857869-152857891 AGCTCAAGGCTGCAGGAGCCAGG + Intergenic
1035215573 7:157363952-157363974 CACCCAGCACTGCAGCAGACAGG - Intronic
1035257106 7:157637450-157637472 CTCCCCAGGCTGCTGGAGGCTGG - Intronic
1035321267 7:158030693-158030715 CACCAGAGGCTGGAGGAGGCAGG + Intronic
1035589240 8:800517-800539 CTCCCAAGGCAGCAGGACACAGG - Intergenic
1036048762 8:5172728-5172750 CACCATAAGCTGAAGGAGACTGG + Intergenic
1036448327 8:8842822-8842844 CACCTGATGCTGCAGGACACAGG + Intronic
1036658249 8:10691432-10691454 CACCCACAGCTGCAGGATGCAGG + Intronic
1037100101 8:15033333-15033355 CACCCATGGCTCCAGGAACCAGG + Intronic
1040423077 8:47259217-47259239 ACCCCAAGGCTGCAGGAGCTAGG + Intergenic
1040860238 8:51991263-51991285 CACCCATGGCAGAAGGAGAAGGG - Intergenic
1041864751 8:62558711-62558733 AACCCAAGTGTGCAGGAGAAAGG - Intronic
1042860288 8:73306227-73306249 AACCCAGGGATGCAGGTGACTGG - Intronic
1044228539 8:89747397-89747419 CACACAAGGGAGCAGGAGAAAGG + Intergenic
1044422572 8:92014782-92014804 CATTCAAGGCTGTAGGAGAATGG + Exonic
1045483533 8:102612214-102612236 CACCCAAGGCAGAAGGTGACGGG + Intergenic
1047816665 8:128471867-128471889 CACCCAAGGCAGCGGGAAGCAGG + Intergenic
1047957110 8:129984491-129984513 CACCCAAGGCCACATGATACTGG + Intronic
1049021716 8:139961625-139961647 CCCCCAAGGGTGCAGGCTACAGG - Intronic
1049573013 8:143378368-143378390 CTCCCAGGGCTGCAGGAGGGTGG - Intronic
1052295506 9:26892771-26892793 CGCCCACGGCCGCAGGAGTCGGG - Exonic
1052989820 9:34512569-34512591 CAGCCAAGGGTTCAGCAGACAGG - Intronic
1053221482 9:36316754-36316776 CTCCCCAGGCTGCCGAAGACGGG + Intergenic
1053576061 9:39358060-39358082 CCCAGGAGGCTGCAGGAGACAGG - Exonic
1053840577 9:42185997-42186019 CCCAGGAGGCTGCAGGAGACAGG - Exonic
1054097633 9:60916751-60916773 CCCAGGAGGCTGCAGGAGACAGG - Intergenic
1054119035 9:61192381-61192403 CCCAGGAGGCTGCAGGAGACAGG - Exonic
1054588717 9:66990181-66990203 CCCAGGAGGCTGCAGGAGACAGG + Intergenic
1054716435 9:68561705-68561727 CAGCCCAGGCTGCAGGACAGTGG + Intergenic
1055787349 9:79884771-79884793 CCCAGATGGCTGCAGGAGACAGG + Intergenic
1056584662 9:87920238-87920260 CCCAGGAGGCTGCAGGAGACAGG - Intergenic
1056612212 9:88132702-88132724 CCCAGGAGGCTGCAGGAGACAGG + Intergenic
1057167792 9:92942129-92942151 CACCCAAGGCTCCAGCACTCCGG - Intergenic
1058230324 9:102417147-102417169 CAGCCACGGCTGGAGCAGACTGG - Intergenic
1059987922 9:119837935-119837957 CAGCCCTGGTTGCAGGAGACTGG - Intergenic
1060280925 9:122214761-122214783 CACCAAAGGCTAGAGGAGATAGG + Intronic
1060924149 9:127443961-127443983 TACCAAAGGCTGAAGGAGTCTGG - Intronic
1060934531 9:127507511-127507533 CCCCCAAGGCGGGATGAGACGGG - Intronic
1061041604 9:128144102-128144124 GGCCCAAGGCTGCAGGGCACAGG - Intergenic
1061359435 9:130131710-130131732 CAGCCATGGCTGCAGGAGACTGG - Intronic
1061520908 9:131117316-131117338 CTCCCCAGGCAGCAGGAGAGTGG + Intronic
1061899583 9:133666125-133666147 GACCCCTGGCTGCAGGAGGCAGG - Intronic
1062523695 9:136969906-136969928 CACACAGGGCTGCAGGGGGCAGG - Exonic
1062560595 9:137139944-137139966 CAGCCAAGGTGGCAGGTGACTGG - Intronic
1062586174 9:137251012-137251034 GACCCCAGGGTGCAGGAGAGGGG + Intergenic
1195664570 X:107417094-107417116 CACCAGAAGCTGGAGGAGACAGG + Intergenic
1196558833 X:117122534-117122556 CTCCCTTGGCTGCAGGAGAGAGG - Intergenic
1197819615 X:130530681-130530703 CACCCAAGGCTGAGGGAGTGGGG - Intergenic