ID: 962895443

View in Genome Browser
Species Human (GRCh38)
Location 3:139709845-139709867
Sequence CAGGAAAGGGACTCAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962895443_962895454 20 Left 962895443 3:139709845-139709867 CCATCCACTGAGTCCCTTTCCTG No data
Right 962895454 3:139709888-139709910 CAGGAGTCCCGCAACTCTCATGG No data
962895443_962895457 28 Left 962895443 3:139709845-139709867 CCATCCACTGAGTCCCTTTCCTG No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
962895443_962895450 1 Left 962895443 3:139709845-139709867 CCATCCACTGAGTCCCTTTCCTG No data
Right 962895450 3:139709869-139709891 GATGAAAACCCCAGAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962895443 Original CRISPR CAGGAAAGGGACTCAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr