ID: 962895447

View in Genome Browser
Species Human (GRCh38)
Location 3:139709858-139709880
Sequence GGGGTTTTCATCCCAGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962895447_962895459 29 Left 962895447 3:139709858-139709880 CCCTTTCCTGGGATGAAAACCCC No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data
962895447_962895458 18 Left 962895447 3:139709858-139709880 CCCTTTCCTGGGATGAAAACCCC No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data
962895447_962895457 15 Left 962895447 3:139709858-139709880 CCCTTTCCTGGGATGAAAACCCC No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
962895447_962895454 7 Left 962895447 3:139709858-139709880 CCCTTTCCTGGGATGAAAACCCC No data
Right 962895454 3:139709888-139709910 CAGGAGTCCCGCAACTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962895447 Original CRISPR GGGGTTTTCATCCCAGGAAA GGG (reversed) Intergenic