ID: 962895448

View in Genome Browser
Species Human (GRCh38)
Location 3:139709859-139709881
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962895448_962895454 6 Left 962895448 3:139709859-139709881 CCTTTCCTGGGATGAAAACCCCA No data
Right 962895454 3:139709888-139709910 CAGGAGTCCCGCAACTCTCATGG No data
962895448_962895457 14 Left 962895448 3:139709859-139709881 CCTTTCCTGGGATGAAAACCCCA No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
962895448_962895458 17 Left 962895448 3:139709859-139709881 CCTTTCCTGGGATGAAAACCCCA No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data
962895448_962895459 28 Left 962895448 3:139709859-139709881 CCTTTCCTGGGATGAAAACCCCA No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962895448 Original CRISPR TGGGGTTTTCATCCCAGGAA AGG (reversed) Intergenic