ID: 962895449

View in Genome Browser
Species Human (GRCh38)
Location 3:139709864-139709886
Sequence ATCTCTGGGGTTTTCATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962895449_962895460 29 Left 962895449 3:139709864-139709886 CCTGGGATGAAAACCCCAGAGAT No data
Right 962895460 3:139709916-139709938 CGGAGGTGATGTCATGGATTTGG No data
962895449_962895459 23 Left 962895449 3:139709864-139709886 CCTGGGATGAAAACCCCAGAGAT No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data
962895449_962895458 12 Left 962895449 3:139709864-139709886 CCTGGGATGAAAACCCCAGAGAT No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data
962895449_962895461 30 Left 962895449 3:139709864-139709886 CCTGGGATGAAAACCCCAGAGAT No data
Right 962895461 3:139709917-139709939 GGAGGTGATGTCATGGATTTGGG No data
962895449_962895457 9 Left 962895449 3:139709864-139709886 CCTGGGATGAAAACCCCAGAGAT No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
962895449_962895454 1 Left 962895449 3:139709864-139709886 CCTGGGATGAAAACCCCAGAGAT No data
Right 962895454 3:139709888-139709910 CAGGAGTCCCGCAACTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962895449 Original CRISPR ATCTCTGGGGTTTTCATCCC AGG (reversed) Intergenic