ID: 962895451

View in Genome Browser
Species Human (GRCh38)
Location 3:139709877-139709899
Sequence GCGGGACTCCTGAATCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962895451_962895463 19 Left 962895451 3:139709877-139709899 CCCCAGAGATTCAGGAGTCCCGC No data
Right 962895463 3:139709919-139709941 AGGTGATGTCATGGATTTGGGGG No data
962895451_962895462 18 Left 962895451 3:139709877-139709899 CCCCAGAGATTCAGGAGTCCCGC No data
Right 962895462 3:139709918-139709940 GAGGTGATGTCATGGATTTGGGG No data
962895451_962895459 10 Left 962895451 3:139709877-139709899 CCCCAGAGATTCAGGAGTCCCGC No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data
962895451_962895464 22 Left 962895451 3:139709877-139709899 CCCCAGAGATTCAGGAGTCCCGC No data
Right 962895464 3:139709922-139709944 TGATGTCATGGATTTGGGGGTGG No data
962895451_962895460 16 Left 962895451 3:139709877-139709899 CCCCAGAGATTCAGGAGTCCCGC No data
Right 962895460 3:139709916-139709938 CGGAGGTGATGTCATGGATTTGG No data
962895451_962895461 17 Left 962895451 3:139709877-139709899 CCCCAGAGATTCAGGAGTCCCGC No data
Right 962895461 3:139709917-139709939 GGAGGTGATGTCATGGATTTGGG No data
962895451_962895458 -1 Left 962895451 3:139709877-139709899 CCCCAGAGATTCAGGAGTCCCGC No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data
962895451_962895457 -4 Left 962895451 3:139709877-139709899 CCCCAGAGATTCAGGAGTCCCGC No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962895451 Original CRISPR GCGGGACTCCTGAATCTCTG GGG (reversed) Intergenic