ID: 962895453

View in Genome Browser
Species Human (GRCh38)
Location 3:139709879-139709901
Sequence TTGCGGGACTCCTGAATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962895453_962895458 -3 Left 962895453 3:139709879-139709901 CCAGAGATTCAGGAGTCCCGCAA No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data
962895453_962895462 16 Left 962895453 3:139709879-139709901 CCAGAGATTCAGGAGTCCCGCAA No data
Right 962895462 3:139709918-139709940 GAGGTGATGTCATGGATTTGGGG No data
962895453_962895459 8 Left 962895453 3:139709879-139709901 CCAGAGATTCAGGAGTCCCGCAA No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data
962895453_962895461 15 Left 962895453 3:139709879-139709901 CCAGAGATTCAGGAGTCCCGCAA No data
Right 962895461 3:139709917-139709939 GGAGGTGATGTCATGGATTTGGG No data
962895453_962895464 20 Left 962895453 3:139709879-139709901 CCAGAGATTCAGGAGTCCCGCAA No data
Right 962895464 3:139709922-139709944 TGATGTCATGGATTTGGGGGTGG No data
962895453_962895460 14 Left 962895453 3:139709879-139709901 CCAGAGATTCAGGAGTCCCGCAA No data
Right 962895460 3:139709916-139709938 CGGAGGTGATGTCATGGATTTGG No data
962895453_962895463 17 Left 962895453 3:139709879-139709901 CCAGAGATTCAGGAGTCCCGCAA No data
Right 962895463 3:139709919-139709941 AGGTGATGTCATGGATTTGGGGG No data
962895453_962895457 -6 Left 962895453 3:139709879-139709901 CCAGAGATTCAGGAGTCCCGCAA No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962895453 Original CRISPR TTGCGGGACTCCTGAATCTC TGG (reversed) Intergenic