ID: 962895454

View in Genome Browser
Species Human (GRCh38)
Location 3:139709888-139709910
Sequence CAGGAGTCCCGCAACTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962895449_962895454 1 Left 962895449 3:139709864-139709886 CCTGGGATGAAAACCCCAGAGAT No data
Right 962895454 3:139709888-139709910 CAGGAGTCCCGCAACTCTCATGG No data
962895447_962895454 7 Left 962895447 3:139709858-139709880 CCCTTTCCTGGGATGAAAACCCC No data
Right 962895454 3:139709888-139709910 CAGGAGTCCCGCAACTCTCATGG No data
962895446_962895454 16 Left 962895446 3:139709849-139709871 CCACTGAGTCCCTTTCCTGGGAT No data
Right 962895454 3:139709888-139709910 CAGGAGTCCCGCAACTCTCATGG No data
962895443_962895454 20 Left 962895443 3:139709845-139709867 CCATCCACTGAGTCCCTTTCCTG No data
Right 962895454 3:139709888-139709910 CAGGAGTCCCGCAACTCTCATGG No data
962895448_962895454 6 Left 962895448 3:139709859-139709881 CCTTTCCTGGGATGAAAACCCCA No data
Right 962895454 3:139709888-139709910 CAGGAGTCCCGCAACTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962895454 Original CRISPR CAGGAGTCCCGCAACTCTCA TGG Intergenic
No off target data available for this crispr