ID: 962895457

View in Genome Browser
Species Human (GRCh38)
Location 3:139709896-139709918
Sequence CCGCAACTCTCATGGCTTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962895449_962895457 9 Left 962895449 3:139709864-139709886 CCTGGGATGAAAACCCCAGAGAT No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
962895451_962895457 -4 Left 962895451 3:139709877-139709899 CCCCAGAGATTCAGGAGTCCCGC No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
962895452_962895457 -5 Left 962895452 3:139709878-139709900 CCCAGAGATTCAGGAGTCCCGCA No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
962895446_962895457 24 Left 962895446 3:139709849-139709871 CCACTGAGTCCCTTTCCTGGGAT No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
962895448_962895457 14 Left 962895448 3:139709859-139709881 CCTTTCCTGGGATGAAAACCCCA No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
962895443_962895457 28 Left 962895443 3:139709845-139709867 CCATCCACTGAGTCCCTTTCCTG No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
962895453_962895457 -6 Left 962895453 3:139709879-139709901 CCAGAGATTCAGGAGTCCCGCAA No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
962895447_962895457 15 Left 962895447 3:139709858-139709880 CCCTTTCCTGGGATGAAAACCCC No data
Right 962895457 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962895457 Original CRISPR CCGCAACTCTCATGGCTTCA CGG Intergenic