ID: 962895458

View in Genome Browser
Species Human (GRCh38)
Location 3:139709899-139709921
Sequence CAACTCTCATGGCTTCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962895449_962895458 12 Left 962895449 3:139709864-139709886 CCTGGGATGAAAACCCCAGAGAT No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data
962895448_962895458 17 Left 962895448 3:139709859-139709881 CCTTTCCTGGGATGAAAACCCCA No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data
962895446_962895458 27 Left 962895446 3:139709849-139709871 CCACTGAGTCCCTTTCCTGGGAT No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data
962895451_962895458 -1 Left 962895451 3:139709877-139709899 CCCCAGAGATTCAGGAGTCCCGC No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data
962895447_962895458 18 Left 962895447 3:139709858-139709880 CCCTTTCCTGGGATGAAAACCCC No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data
962895452_962895458 -2 Left 962895452 3:139709878-139709900 CCCAGAGATTCAGGAGTCCCGCA No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data
962895453_962895458 -3 Left 962895453 3:139709879-139709901 CCAGAGATTCAGGAGTCCCGCAA No data
Right 962895458 3:139709899-139709921 CAACTCTCATGGCTTCACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962895458 Original CRISPR CAACTCTCATGGCTTCACGG AGG Intergenic