ID: 962895459

View in Genome Browser
Species Human (GRCh38)
Location 3:139709910-139709932
Sequence GCTTCACGGAGGTGATGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962895453_962895459 8 Left 962895453 3:139709879-139709901 CCAGAGATTCAGGAGTCCCGCAA No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data
962895448_962895459 28 Left 962895448 3:139709859-139709881 CCTTTCCTGGGATGAAAACCCCA No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data
962895447_962895459 29 Left 962895447 3:139709858-139709880 CCCTTTCCTGGGATGAAAACCCC No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data
962895451_962895459 10 Left 962895451 3:139709877-139709899 CCCCAGAGATTCAGGAGTCCCGC No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data
962895449_962895459 23 Left 962895449 3:139709864-139709886 CCTGGGATGAAAACCCCAGAGAT No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data
962895452_962895459 9 Left 962895452 3:139709878-139709900 CCCAGAGATTCAGGAGTCCCGCA No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data
962895456_962895459 -9 Left 962895456 3:139709896-139709918 CCGCAACTCTCATGGCTTCACGG No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data
962895455_962895459 -8 Left 962895455 3:139709895-139709917 CCCGCAACTCTCATGGCTTCACG No data
Right 962895459 3:139709910-139709932 GCTTCACGGAGGTGATGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962895459 Original CRISPR GCTTCACGGAGGTGATGTCA TGG Intergenic