ID: 962896299

View in Genome Browser
Species Human (GRCh38)
Location 3:139718052-139718074
Sequence TTCTCAAGACTGTTTTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962896299_962896301 4 Left 962896299 3:139718052-139718074 CCAGATAAAAACAGTCTTGAGAA No data
Right 962896301 3:139718079-139718101 TGAGAGACAAGATCCCCTAGAGG No data
962896299_962896304 7 Left 962896299 3:139718052-139718074 CCAGATAAAAACAGTCTTGAGAA No data
Right 962896304 3:139718082-139718104 GAGACAAGATCCCCTAGAGGGGG No data
962896299_962896303 6 Left 962896299 3:139718052-139718074 CCAGATAAAAACAGTCTTGAGAA No data
Right 962896303 3:139718081-139718103 AGAGACAAGATCCCCTAGAGGGG No data
962896299_962896302 5 Left 962896299 3:139718052-139718074 CCAGATAAAAACAGTCTTGAGAA No data
Right 962896302 3:139718080-139718102 GAGAGACAAGATCCCCTAGAGGG No data
962896299_962896307 18 Left 962896299 3:139718052-139718074 CCAGATAAAAACAGTCTTGAGAA No data
Right 962896307 3:139718093-139718115 CCCTAGAGGGGGCCAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962896299 Original CRISPR TTCTCAAGACTGTTTTTATC TGG (reversed) Intergenic
No off target data available for this crispr