ID: 962897366

View in Genome Browser
Species Human (GRCh38)
Location 3:139728431-139728453
Sequence CCCCTTGCGCATCTCTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962897366_962897374 17 Left 962897366 3:139728431-139728453 CCCCTGCAGAGATGCGCAAGGGG No data
Right 962897374 3:139728471-139728493 GCCCTCCACCACCAGGCAAGCGG No data
962897366_962897372 10 Left 962897366 3:139728431-139728453 CCCCTGCAGAGATGCGCAAGGGG No data
Right 962897372 3:139728464-139728486 TGTCCAGGCCCTCCACCACCAGG No data
962897366_962897371 -5 Left 962897366 3:139728431-139728453 CCCCTGCAGAGATGCGCAAGGGG No data
Right 962897371 3:139728449-139728471 AGGGGGCTTGAAGATTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962897366 Original CRISPR CCCCTTGCGCATCTCTGCAG GGG (reversed) Intergenic
No off target data available for this crispr