ID: 962898945

View in Genome Browser
Species Human (GRCh38)
Location 3:139740344-139740366
Sequence CAGGAGCCTGGACTTTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962898945_962898949 -5 Left 962898945 3:139740344-139740366 CCACACAAAAGTCCAGGCTCCTG No data
Right 962898949 3:139740362-139740384 TCCTGCCCTGATGGGACCTCTGG No data
962898945_962898954 8 Left 962898945 3:139740344-139740366 CCACACAAAAGTCCAGGCTCCTG No data
Right 962898954 3:139740375-139740397 GGACCTCTGGTCACATCACTGGG No data
962898945_962898958 30 Left 962898945 3:139740344-139740366 CCACACAAAAGTCCAGGCTCCTG No data
Right 962898958 3:139740397-139740419 GCATATAGGGTGACAGAGTATGG No data
962898945_962898957 17 Left 962898945 3:139740344-139740366 CCACACAAAAGTCCAGGCTCCTG No data
Right 962898957 3:139740384-139740406 GTCACATCACTGGGCATATAGGG No data
962898945_962898956 16 Left 962898945 3:139740344-139740366 CCACACAAAAGTCCAGGCTCCTG No data
Right 962898956 3:139740383-139740405 GGTCACATCACTGGGCATATAGG No data
962898945_962898953 7 Left 962898945 3:139740344-139740366 CCACACAAAAGTCCAGGCTCCTG No data
Right 962898953 3:139740374-139740396 GGGACCTCTGGTCACATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962898945 Original CRISPR CAGGAGCCTGGACTTTTGTG TGG (reversed) Intergenic
No off target data available for this crispr