ID: 962905512

View in Genome Browser
Species Human (GRCh38)
Location 3:139797953-139797975
Sequence TTTTCCAGCTTGATGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962905508_962905512 14 Left 962905508 3:139797916-139797938 CCGCGGCTATGAGCGCTGTCCTT No data
Right 962905512 3:139797953-139797975 TTTTCCAGCTTGATGAGTGAGGG No data
962905510_962905512 -5 Left 962905510 3:139797935-139797957 CCTTGGTGCTGAAGCATCTTTTC No data
Right 962905512 3:139797953-139797975 TTTTCCAGCTTGATGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962905512 Original CRISPR TTTTCCAGCTTGATGAGTGA GGG Intergenic
No off target data available for this crispr