ID: 962908313

View in Genome Browser
Species Human (GRCh38)
Location 3:139825225-139825247
Sequence TGGGAAGCCTTGGGAAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962908308_962908313 3 Left 962908308 3:139825199-139825221 CCTTGTGAGTGAGGAATCGGTAT No data
Right 962908313 3:139825225-139825247 TGGGAAGCCTTGGGAAGAATTGG No data
962908305_962908313 18 Left 962908305 3:139825184-139825206 CCAGATCAAGCATGGCCTTGTGA No data
Right 962908313 3:139825225-139825247 TGGGAAGCCTTGGGAAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962908313 Original CRISPR TGGGAAGCCTTGGGAAGAAT TGG Intergenic
No off target data available for this crispr