ID: 962911628

View in Genome Browser
Species Human (GRCh38)
Location 3:139856246-139856268
Sequence CAATCTATGCACAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962911619_962911628 24 Left 962911619 3:139856199-139856221 CCTGGAGATCTTCCTGGGTGTGG No data
Right 962911628 3:139856246-139856268 CAATCTATGCACAGGGAGGATGG No data
962911623_962911628 12 Left 962911623 3:139856211-139856233 CCTGGGTGTGGAGCAGAGAGGGC No data
Right 962911628 3:139856246-139856268 CAATCTATGCACAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962911628 Original CRISPR CAATCTATGCACAGGGAGGA TGG Intergenic
No off target data available for this crispr