ID: 962914887

View in Genome Browser
Species Human (GRCh38)
Location 3:139892139-139892161
Sequence GTACAACTGCACCAAGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962914887_962914892 7 Left 962914887 3:139892139-139892161 CCACTGCCTTGGTGCAGTTGTAC No data
Right 962914892 3:139892169-139892191 TGCACATTCCAGGTGGCATTAGG No data
962914887_962914896 15 Left 962914887 3:139892139-139892161 CCACTGCCTTGGTGCAGTTGTAC No data
Right 962914896 3:139892177-139892199 CCAGGTGGCATTAGGGAGCTGGG No data
962914887_962914898 23 Left 962914887 3:139892139-139892161 CCACTGCCTTGGTGCAGTTGTAC No data
Right 962914898 3:139892185-139892207 CATTAGGGAGCTGGGGCCACTGG No data
962914887_962914897 16 Left 962914887 3:139892139-139892161 CCACTGCCTTGGTGCAGTTGTAC No data
Right 962914897 3:139892178-139892200 CAGGTGGCATTAGGGAGCTGGGG No data
962914887_962914889 -3 Left 962914887 3:139892139-139892161 CCACTGCCTTGGTGCAGTTGTAC No data
Right 962914889 3:139892159-139892181 TACACCAGACTGCACATTCCAGG No data
962914887_962914894 14 Left 962914887 3:139892139-139892161 CCACTGCCTTGGTGCAGTTGTAC No data
Right 962914894 3:139892176-139892198 TCCAGGTGGCATTAGGGAGCTGG No data
962914887_962914890 0 Left 962914887 3:139892139-139892161 CCACTGCCTTGGTGCAGTTGTAC No data
Right 962914890 3:139892162-139892184 ACCAGACTGCACATTCCAGGTGG No data
962914887_962914893 8 Left 962914887 3:139892139-139892161 CCACTGCCTTGGTGCAGTTGTAC No data
Right 962914893 3:139892170-139892192 GCACATTCCAGGTGGCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962914887 Original CRISPR GTACAACTGCACCAAGGCAG TGG (reversed) Intergenic
No off target data available for this crispr