ID: 962915909

View in Genome Browser
Species Human (GRCh38)
Location 3:139903111-139903133
Sequence GACATAGATATGACTACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962915909_962915910 -1 Left 962915909 3:139903111-139903133 CCTGATGTAGTCATATCTATGTC No data
Right 962915910 3:139903133-139903155 CTTTATAGTGAACAATTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962915909 Original CRISPR GACATAGATATGACTACATC AGG (reversed) Intergenic
No off target data available for this crispr