ID: 962918814

View in Genome Browser
Species Human (GRCh38)
Location 3:139933639-139933661
Sequence ATGTGGGGCTCTTTACCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962918814 Original CRISPR ATGTGGGGCTCTTTACCTTC AGG (reversed) Intergenic
908203977 1:61826113-61826135 ACGTGGGTCTCTTTACCATGTGG + Intronic
909503368 1:76360324-76360346 ATGTTGTTCTCTTTACATTCAGG + Intronic
911509821 1:98797775-98797797 ATATGGGGCTTTTTGCTTTCTGG + Intergenic
915092288 1:153434954-153434976 AGGTGGGCCTCTTTGCCTCCAGG + Intergenic
920058467 1:203211119-203211141 ATTTGGGGCTATTTACTTTTTGG - Intergenic
1063033143 10:2256291-2256313 ATGATGGGCTCTGTACCTGCAGG + Intergenic
1065544685 10:26807651-26807673 ATTTGGGGCTCTTTCCCTTCAGG + Intronic
1065931176 10:30480304-30480326 ATGGGGGGGCCTTTACATTCTGG - Intergenic
1068656418 10:59580633-59580655 ATGAGGGACTATTTACTTTCAGG + Intergenic
1069857335 10:71448590-71448612 ATGTTGGGCTCCTGACTTTCAGG - Intronic
1073229495 10:101956419-101956441 ATGTGGGCCTTTTTGCCTTTAGG - Intronic
1073568213 10:104553781-104553803 ATGTGGATCTCTCTACTTTCTGG + Intergenic
1076255283 10:129018473-129018495 ATGTGGGTCTCTTTGCTTCCAGG - Intergenic
1079098032 11:17523391-17523413 ATGTGGGGGTCTTCACCTGTTGG - Intronic
1080501006 11:32870896-32870918 ATGTGGGGCTGTGTGCCCTCTGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1089991683 11:122867247-122867269 ATGTAAGTCTCTTTACCTTCAGG + Intronic
1091665994 12:2418882-2418904 CTGAGGGGTTCTTTACCTCCTGG + Intronic
1092942416 12:13422402-13422424 TTGTGGGGCTTTTTACTTGCTGG - Intergenic
1096757697 12:53813877-53813899 ATGTGGGCCTATTAACCTCCAGG - Intergenic
1103567486 12:121823763-121823785 ATGGGGGGCTCTGCACCTTCTGG + Intronic
1106596209 13:31141210-31141232 ATTTTGGGCTTTTTAGCTTCTGG + Exonic
1109906455 13:68847658-68847680 ATGTTGGACTCTTTAAGTTCCGG - Intergenic
1112357382 13:98685285-98685307 ACGTGGGGCTCTTAACTTGCTGG - Intronic
1114543026 14:23477413-23477435 ATGTGGGGCTTATTACCATGAGG + Intronic
1118463443 14:66008743-66008765 ATGTGGGGAGCTGGACCTTCAGG + Intergenic
1119138092 14:72239129-72239151 AAACGGGGCTCTTGACCTTCAGG - Intronic
1119302728 14:73584217-73584239 AAACGGGGCTCTTGACCTTCAGG + Intergenic
1120503300 14:85323645-85323667 CTGTGGGGCTTTTCTCCTTCTGG - Intergenic
1123633539 15:22279268-22279290 ATGTAAGGCTCCTTACCTCCTGG - Intergenic
1128761168 15:70216942-70216964 GTGTGGTGCTCTTTGACTTCGGG + Intergenic
1131776403 15:95804838-95804860 ATCAGGGGCCCTTTACCTTATGG - Intergenic
1133720277 16:8488296-8488318 ATTTCTGGCTCTGTACCTTCTGG - Intergenic
1140606821 16:76549104-76549126 TTGTGGGGCTTCCTACCTTCTGG + Intronic
1140950131 16:79808959-79808981 ATTTCTGGCTCTTCACCTTCTGG - Intergenic
1143928492 17:10395117-10395139 ATGTGGACCCGTTTACCTTCAGG + Exonic
1147631497 17:41935210-41935232 TTGTCAGGCTCTTTACCTTCAGG + Exonic
1148339121 17:46863013-46863035 CTGTGGGGCCCTGTACCTTGGGG - Intronic
1150858533 17:68776769-68776791 ATATGGGGCTGTTTCCCTCCTGG + Intergenic
1151851840 17:76695332-76695354 AGGGGTGGCTCTTTAGCTTCAGG + Intronic
1155100576 18:22606662-22606684 ATCTGGGGCTCTTAACTTTTTGG - Intergenic
1157304769 18:46508946-46508968 CTGTGCGGCTCTGTGCCTTCAGG - Intronic
1159885722 18:73903282-73903304 TTGTGGGGATCTTCACCTGCGGG - Intergenic
1161776874 19:6268214-6268236 ATGTGAGCCTGTTTACCTTTGGG - Intronic
1164593230 19:29517589-29517611 AGGTGGGGCCCTAGACCTTCAGG + Intergenic
1165495355 19:36149630-36149652 ATATGGGGGTCCTTACCTCCTGG - Exonic
1167484105 19:49750581-49750603 CTCTGGGTCTCTTTTCCTTCAGG - Intronic
926049509 2:9735538-9735560 ATTTGAGGTTCTTTACCATCTGG - Intergenic
932732700 2:74232262-74232284 AAGTGGGGCTTTTTACCTACTGG - Intronic
932766587 2:74474505-74474527 ATGGGGAGCTCTTAACTTTCTGG + Exonic
934124946 2:88879259-88879281 TTGGGGTGCTCTTTCCCTTCAGG + Intergenic
937403376 2:121605272-121605294 GTGTGGAGCATTTTACCTTCAGG - Intronic
942683200 2:178501226-178501248 CTGTGGGGCTCTGTAATTTCTGG + Intronic
948815778 2:240509860-240509882 GGGTGGGGCTCTTTACACTCAGG - Intronic
1169816177 20:9658998-9659020 ATGGGGGGCTTTTTACCTGTTGG - Intronic
1169914710 20:10673719-10673741 AGGCCGGGCTCTTTGCCTTCTGG - Exonic
1173706574 20:45114555-45114577 ATGTGTGTCTCTGTGCCTTCAGG - Intronic
1175152376 20:56945402-56945424 ATGGGGAGCTCTTTGGCTTCAGG + Intergenic
1175991778 20:62793452-62793474 ATGTGGGGCTCAGCACCCTCGGG + Intergenic
1182669880 22:31987046-31987068 ATGAGGAGCTCACTACCTTCAGG - Intergenic
1182826281 22:33267663-33267685 AAGTGGAGCTTTTTACCTTGAGG + Intronic
953852278 3:46473562-46473584 ATGTAGGGCTGTTTTCCCTCTGG + Intronic
954132288 3:48566891-48566913 AGCTGGGGCCCCTTACCTTCTGG + Exonic
955333865 3:58069179-58069201 ATGTGCTGCTCTTTTCTTTCAGG + Intronic
960775900 3:121252961-121252983 AAGAGTGTCTCTTTACCTTCAGG + Intronic
961870610 3:129985069-129985091 ATGTGGGGCTTCTTACCTGAAGG + Intergenic
962411228 3:135143316-135143338 AGGAGGGGCTCTGGACCTTCAGG + Intronic
962918814 3:139933639-139933661 ATGTGGGGCTCTTTACCTTCAGG - Intergenic
968750809 4:2387926-2387948 ATGTGGGGCCCTTTTCCTGTGGG - Intronic
973825098 4:54696879-54696901 ATGTGCTGTTCTTTACATTCAGG + Intronic
974673557 4:65062009-65062031 TTGTGGGCCTCTTTCCCTTAGGG + Intergenic
974965862 4:68760084-68760106 AGATGGGGCTCCATACCTTCAGG - Intergenic
976323929 4:83749799-83749821 GAGAGGGGCTCTTTACCTTGTGG + Intergenic
977217690 4:94301236-94301258 AGGTGGAGGTCTCTACCTTCAGG - Intronic
979303589 4:119115793-119115815 ATGTTGGGCTCCATACTTTCAGG + Intergenic
981345502 4:143672210-143672232 ATGTTGGACTCTCTACCTTTGGG - Intronic
986508091 5:8473662-8473684 ATGTGGGGCTATTCACTTTTGGG - Intergenic
991996897 5:72396597-72396619 ATGCAGGGCTCTTTGCCTGCAGG + Intergenic
995566903 5:113440302-113440324 ATCTGAGGCTCTTTATCATCTGG + Intronic
996442309 5:123505947-123505969 TTGTGAGGCTCTCTAGCTTCAGG - Intergenic
998788388 5:145737856-145737878 CAGTGGGGCTCATTACCTGCTGG - Intronic
998811533 5:145971401-145971423 ATGTGGGGCTCCCTACCTGTGGG + Intronic
999175412 5:149628594-149628616 ATGGGGGGCTCATTCCCTACCGG - Intronic
1001685985 5:173595490-173595512 ATTTGGGGCTATTTATCTCCCGG + Intergenic
1004868730 6:19881214-19881236 ATATGAGGCTCTTTATGTTCAGG - Intergenic
1010787445 6:80021003-80021025 ATTTGGGTCTCTTTGCCATCTGG - Intronic
1014118448 6:117694125-117694147 CTGTGGGTCTCTTTTGCTTCTGG - Exonic
1015237010 6:130983048-130983070 ATGTGAGGCTGTTTACCTAAAGG - Intronic
1020442094 7:8228306-8228328 ATCTTGGGCTTTTTACCTTCAGG - Intronic
1022107888 7:27209899-27209921 ATGTGGGGCTCATTTCCATGGGG + Intergenic
1023325660 7:39052943-39052965 ATCTGGGGATCCTGACCTTCAGG - Intronic
1026967353 7:74448559-74448581 ATGTGGGGTTCTTTGCGGTCAGG + Intergenic
1032584654 7:133135033-133135055 ATGTATGGCTCTTTCCCTTGAGG - Intergenic
1034419250 7:150980284-150980306 ATGAGTGGCTCCTTCCCTTCAGG - Intergenic
1036538207 8:9673419-9673441 ATTTGGGGCCTTTTACCTTTTGG + Intronic
1039259992 8:35761134-35761156 ATGTAGGTCTCTTTGCTTTCTGG + Intronic
1041182690 8:55265378-55265400 ACATGGGGATCTTAACCTTCTGG - Intronic
1044717081 8:95110309-95110331 TTGTGGAGCTCTTTATCTACAGG + Intronic
1047628462 8:126680609-126680631 ATGTGAGGCTCATTACCATCTGG + Intergenic
1049483717 8:142840394-142840416 GTATGGGGCTCCTTCCCTTCAGG + Exonic
1050163674 9:2742962-2742984 ATGTAGGCTGCTTTACCTTCTGG - Intronic
1051304698 9:15697065-15697087 ATCTGGGCTCCTTTACCTTCTGG + Intronic
1053185273 9:36011011-36011033 ATGTGAGGTTCTTTATCTCCTGG - Intergenic
1055475564 9:76660247-76660269 ATATAGGGCTCTGGACCTTCAGG + Intronic
1055883141 9:81026701-81026723 ATTTGGGTCTTTTTACTTTCTGG - Intergenic
1061867796 9:133503448-133503470 ATCTGGGGTTATTTTCCTTCTGG - Intergenic
1062058664 9:134482802-134482824 ATGTGGGGCTCGTTGCCTTAAGG - Intergenic
1186072727 X:5839814-5839836 CTGTGGGGCTGTGGACCTTCAGG + Intergenic
1186756897 X:12680836-12680858 ACGTGGGGCTATTTACTTTAGGG - Intronic
1190099648 X:47512826-47512848 CTGTGGGTCTCTTTTGCTTCTGG + Intergenic
1192437121 X:71149745-71149767 ACCTGGGTCTCTTGACCTTCAGG + Intronic
1194117801 X:89924151-89924173 ATGTGGGCCTGTTTCCTTTCTGG - Intergenic
1194444353 X:93969189-93969211 ATGTGGGGGTGTGCACCTTCAGG + Intergenic
1196459921 X:115919337-115919359 ATGGGGGGGTCTTTATATTCAGG + Intergenic
1200470580 Y:3581304-3581326 ATGTGGGCCTGTTTCCTTTCTGG - Intergenic