ID: 962920100

View in Genome Browser
Species Human (GRCh38)
Location 3:139942952-139942974
Sequence GCATCTCTGGCCAATCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962920100 Original CRISPR GCATCTCTGGCCAATCTCTG GGG (reversed) Intronic
900163811 1:1236827-1236849 ACAGGCCTGGCCAATCTCTGGGG + Intergenic
901614241 1:10525500-10525522 CCATTTCTGGCCACTCTCTGGGG + Intronic
904702060 1:32363589-32363611 GAATCTCTGGATAAACTCTGAGG - Exonic
905012880 1:34759108-34759130 GCATCGCTGTCCATCCTCTGTGG - Intronic
905742559 1:40385056-40385078 GCAGATCTGGCTCATCTCTGGGG - Intronic
918756657 1:188346038-188346060 CCAGCCCTGGCCAATCCCTGTGG - Intergenic
918799374 1:188953240-188953262 CCCTCTCTGTCTAATCTCTGAGG - Intergenic
920552214 1:206872008-206872030 GCAGCTCTGGCCACTATCAGAGG + Intergenic
921137294 1:212273119-212273141 TCATCTCCAGCCAATCTCTTTGG + Intergenic
922500129 1:226091147-226091169 CCATCTCTGGCCCGTCACTGTGG - Intergenic
923895675 1:238267277-238267299 CCAGCTCTGCCTAATCTCTGAGG + Intergenic
924183059 1:241458573-241458595 CCATCTGGGGCCACTCTCTGTGG - Intergenic
1065857808 10:29844282-29844304 GCATCCCAGGCCAGGCTCTGTGG - Intergenic
1066105074 10:32149039-32149061 GCCTCTCTGGCCTCTCTCTGAGG + Intergenic
1067761429 10:49050505-49050527 GCATCTTTGGGGAATCTCAGTGG - Intronic
1070652252 10:78245829-78245851 GCTTCTCTGGCCCAGCTCTTTGG - Intergenic
1070691804 10:78532588-78532610 GCACCTCTGGCTCCTCTCTGGGG - Intergenic
1074250788 10:111744683-111744705 GCATATCTTACCAATCTCTGTGG + Intergenic
1076111510 10:127863214-127863236 CCATCTCTGGCAAAACTATGTGG - Intergenic
1078196817 11:9143504-9143526 ACATCCCTAACCAATCTCTGAGG + Intronic
1078326114 11:10382574-10382596 GCATCTCTGCCCCCTCTCTCTGG + Intronic
1080285004 11:30600587-30600609 TCATCTCTGCCTACTCTCTGAGG + Intergenic
1082072282 11:47948776-47948798 GCAGCTCTGGCCAGGCTCGGTGG - Intergenic
1087266246 11:96064554-96064576 GCATCTTTGGCAAATCTTTGGGG + Intronic
1087291902 11:96329274-96329296 CCATCTCTGGCCATATTCTGAGG - Intronic
1088503676 11:110508454-110508476 GGCTCTCTGGCCCATCTCTTGGG + Intergenic
1089681524 11:120121520-120121542 GCATCCCTGCCCAAGCACTGTGG - Intronic
1090469640 11:126968932-126968954 GCATGACTGGACAACCTCTGAGG + Intronic
1091141001 11:133234603-133234625 GCTGCTCTGGCCATTCTCTGAGG - Intronic
1091592456 12:1852690-1852712 TCATCACTGACTAATCTCTGAGG + Intronic
1092029541 12:5272790-5272812 CCATCTCTGGCCTATCTCCATGG - Intergenic
1092029553 12:5272877-5272899 CCATCTCTGGCCTATCTCCGTGG - Intergenic
1092029563 12:5272964-5272986 CCATCTCTGGCCTATCTCTGTGG - Intergenic
1094432029 12:30380149-30380171 GGCTGGCTGGCCAATCTCTGTGG - Intergenic
1097176368 12:57145705-57145727 GCATTTCTGGCCAAGGGCTGAGG + Intronic
1098080159 12:66775587-66775609 TCATCTGTGGCCTATTTCTGTGG + Intronic
1098872687 12:75834683-75834705 GCTGCTCTGGGCAATGTCTGTGG - Intergenic
1100176128 12:92033017-92033039 CCATCTCTGACCAATCACTGTGG + Intronic
1100985415 12:100198568-100198590 GCATCCCTGCCCACTCTCGGAGG + Intergenic
1102022122 12:109690774-109690796 GTATCACTTGCCAATTTCTGTGG + Intergenic
1103055657 12:117818175-117818197 GGATCAATGGGCAATCTCTGGGG + Intronic
1103877609 12:124140835-124140857 TCATCTATGGACCATCTCTGAGG + Intronic
1103985538 12:124764978-124765000 GCATCTCTGGTCATGCACTGTGG - Intergenic
1104329945 12:127835349-127835371 GAATCTCTGCCCAGTCTCAGCGG - Intergenic
1104520226 12:129467469-129467491 CCATCCCTGACCAATCACTGTGG + Intronic
1104806696 12:131593993-131594015 GTATCTCTGGTCCCTCTCTGAGG + Intergenic
1106290536 13:28357237-28357259 ACTACTCTGGCCACTCTCTGTGG + Intronic
1112104594 13:96227059-96227081 GTATTTTTGGCCAATCTCTTGGG + Intronic
1112353631 13:98656598-98656620 GCAACTCTGGCCAAGCCATGTGG + Intergenic
1113628211 13:111862119-111862141 GCAGCATTGGCCAATTTCTGTGG + Intergenic
1115792962 14:36900283-36900305 GAATCCCTGGCCAATTGCTGTGG + Intronic
1116785049 14:49278915-49278937 GTAACTCTTGCCAATTTCTGTGG - Intergenic
1118348943 14:64959972-64959994 GCTTTTCTTGCCAATGTCTGAGG - Intronic
1118475381 14:66111569-66111591 GCATCTTAGTCCAATCACTGTGG + Intergenic
1118503501 14:66386332-66386354 TCTTCTCTAGCCAAACTCTGTGG + Intergenic
1119603681 14:75995922-75995944 GCATCGCTGACCCATCCCTGGGG + Intronic
1121727402 14:96162813-96162835 GCATCACTGGGAAATCACTGGGG - Intergenic
1122301000 14:100731076-100731098 CTTTCCCTGGCCAATCTCTGAGG - Intronic
1124035130 15:26047728-26047750 GCTCCTCTGATCAATCTCTGGGG - Intergenic
1126386849 15:48102251-48102273 GTATTTCTGGCCATTCTCTCAGG + Intergenic
1131697331 15:94892163-94892185 GCATCTCTGCCCTACCTCAGAGG - Intergenic
1131900743 15:97085346-97085368 GCATCTCTGGCCAGGCGCAGTGG - Intergenic
1134683996 16:16146143-16146165 GCATCTCTGCCCAAGCAGTGTGG - Intergenic
1136284812 16:29234515-29234537 ACACCTCTGGCCACTCTGTGGGG - Intergenic
1139614225 16:68079384-68079406 GGATCTCCTGCCCATCTCTGTGG + Intergenic
1141799147 16:86295380-86295402 GCATCTGTGGCCAGCATCTGTGG - Intergenic
1141799158 16:86295447-86295469 GCATCTCTGGCCAGCATCTGTGG - Intergenic
1141799167 16:86295500-86295522 GCATCTGTGGCCAGCATCTGTGG - Intergenic
1141799201 16:86295700-86295722 GCATCTGTGGCCAGCATCTGTGG - Intergenic
1142089831 16:88203991-88204013 ACACCTCTGGCCACTCTGTGGGG - Intergenic
1145271857 17:21409120-21409142 CCATCTCTGACCAAGCTCAGAGG - Intronic
1145310069 17:21696585-21696607 CCATCTCTGACCAAGCTCAGAGG - Intronic
1147635517 17:41961609-41961631 GCAGCCCTAGCCTATCTCTGGGG + Intronic
1149092750 17:52803999-52804021 GCATCTATGGACATGCTCTGGGG - Intergenic
1150069878 17:62141338-62141360 TCATCTCTGGCCAGTCGCGGTGG + Intergenic
1150133201 17:62680301-62680323 GCCACTCCGGCCAACCTCTGGGG - Exonic
1151644208 17:75418812-75418834 GCATCTCAGGCCAGGCACTGGGG + Intergenic
1151961068 17:77405895-77405917 ACAGCTCTGACCAATCTCTGCGG + Intronic
1152827923 17:82479216-82479238 GCATCTCTGGGCAAGGTCCGGGG - Intronic
1152845284 17:82596032-82596054 GCATCTCTGGCCTACCGCAGTGG + Intronic
1154112108 18:11579107-11579129 TCAGCCCTGACCAATCTCTGTGG + Intergenic
1156343140 18:36230458-36230480 GAATCTCTGGCCAATCTGATTGG - Intronic
1156912929 18:42432278-42432300 GTTTCTCTCGCCAATGTCTGAGG - Intergenic
1157053541 18:44198264-44198286 CTATCTCTGTCTAATCTCTGGGG - Intergenic
1157508685 18:48251751-48251773 CCTGCTCTGACCAATCTCTGCGG + Intronic
1157535814 18:48456524-48456546 TCATCTCTGGTCTTTCTCTGTGG - Intergenic
1163648449 19:18503407-18503429 GCACGTCTGGCCAGGCTCTGAGG + Intronic
1163697325 19:18770438-18770460 GCAGGTCTGGCCCACCTCTGGGG - Intronic
1164598527 19:29546116-29546138 TCTTCTCTGGCCCATCTCAGAGG - Intronic
1166979007 19:46621845-46621867 GCATCTCTGGCAATTTCCTGGGG - Intronic
1168708223 19:58481629-58481651 GGATCTCTGGGCAGTCACTGGGG + Intronic
925177860 2:1797812-1797834 GCCTCTCCTGCCACTCTCTGCGG - Intronic
925182282 2:1825056-1825078 GGCTCTCAGGCCACTCTCTGAGG - Intronic
925306432 2:2850539-2850561 GCATCTGGGGCGCATCTCTGTGG - Intergenic
927136156 2:20097858-20097880 GTGTCTCTGGCCCATCCCTGTGG - Intergenic
928130956 2:28649689-28649711 GCACCTCTGTCCTCTCTCTGTGG + Intergenic
928929620 2:36610950-36610972 TCATATCTGTCCCATCTCTGTGG - Intronic
930087275 2:47506702-47506724 GCAGCTGTGGCAAATCTCTCTGG + Intronic
934697946 2:96413713-96413735 GCTTCTCTGGCCAATCCTAGGGG - Intergenic
936040574 2:109146391-109146413 GTATCACTGGCCCATTTCTGTGG + Intronic
937472636 2:122187196-122187218 CCATCTCTTATCAATCTCTGTGG + Intergenic
937895908 2:126976710-126976732 GCCTCTCTGGGGACTCTCTGGGG - Intergenic
940599882 2:155845406-155845428 ACTGCTCTGGCCAAACTCTGCGG - Intergenic
941183006 2:162284082-162284104 GAATCTAGGGACAATCTCTGGGG + Intronic
941648404 2:168066838-168066860 GCATCTCTGCACATTTTCTGAGG - Intronic
943484696 2:188464921-188464943 GCATTTCTGGACCTTCTCTGGGG - Intronic
1168876061 20:1173143-1173165 GGATCTCTGTCCAATCTAAGAGG + Intronic
1172185536 20:33028869-33028891 TCATCTCTGTCCCATCTCTCTGG + Intergenic
1172577928 20:36023553-36023575 GCAGACCTGGCCAGTCTCTGAGG + Intronic
1172774451 20:37398895-37398917 GGGGCTCAGGCCAATCTCTGTGG - Intronic
1173160497 20:40648579-40648601 ATATGTCTTGCCAATCTCTGAGG + Intergenic
1174420018 20:50393458-50393480 GAGTCTCTGGCCACTCCCTGGGG - Intergenic
1174427145 20:50439762-50439784 CCATCTCAGACCAATCCCTGGGG - Intergenic
1175760031 20:61556119-61556141 GCATCCCTGGCAAACTTCTGTGG - Intronic
1178830508 21:36052862-36052884 GCAACTCTGGCCCAAGTCTGAGG + Intronic
1179710593 21:43210935-43210957 GCATCTCTGCCCACTCTCCAAGG - Intergenic
1179797443 21:43793572-43793594 GCAGCTTTGTCCAGTCTCTGAGG + Intronic
1181544596 22:23594798-23594820 GGATCTCTGGCCCAGGTCTGAGG - Intergenic
1184762122 22:46550644-46550666 GGATGTCTGGCCTCTCTCTGGGG - Intergenic
1185343776 22:50302681-50302703 GCTCCCCTGGCCAATCTCTGAGG + Intronic
950648009 3:14389210-14389232 GCTGCTCAGGCCAATCTCTTGGG - Intergenic
953741523 3:45542977-45542999 GCCTGGCTGGCCAACCTCTGTGG - Intronic
956013830 3:64860050-64860072 GCATTTCTGGGCCATCTCTGTGG + Intergenic
956364583 3:68486346-68486368 GCTTATCTGGCCACTCCCTGTGG + Intronic
956673303 3:71711687-71711709 GCATTTCTGGCCAGCCGCTGTGG + Intronic
957109435 3:75933785-75933807 GCATCTCTGGCTTCTATCTGTGG - Intronic
958945278 3:100354968-100354990 GGTTCTCTGGCCAATCCCTGGGG + Intronic
960288572 3:115857084-115857106 GCATCTCTGGCCATGTCCTGAGG + Intronic
960561043 3:119084458-119084480 CCATTTCTGTCTAATCTCTGGGG - Intronic
961483363 3:127197857-127197879 GCATCCCTGGCCACCCTGTGGGG + Exonic
961624931 3:128255199-128255221 GCCTCTCTGGCCACTCTTTGGGG + Intronic
962920100 3:139942952-139942974 GCATCTCTGGCCAATCTCTGGGG - Intronic
965740111 3:171865358-171865380 GCTTCTCTGGCCAGTCTGGGAGG - Intronic
969573678 4:8024476-8024498 GCGTCTCTGGCCCCTCTCAGTGG - Intronic
971268774 4:25117931-25117953 GCATCTCTAGCAAATCCCTAGGG - Intergenic
971479674 4:27103166-27103188 GCATCTCTGGAGCAGCTCTGAGG - Intergenic
971620385 4:28848341-28848363 GCAACTCTGCCCTATCTCTGGGG - Intergenic
977440308 4:97057908-97057930 GCACCTCTGGGAAATCTCTTGGG - Intergenic
978522350 4:109629735-109629757 GCACTTCTGTCCACTCTCTGGGG + Intronic
983640540 4:169940780-169940802 GCATTTCTGTCAAATCTCTGAGG + Intergenic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
994666142 5:102707906-102707928 GTATCTCTTGCCAATCACTGTGG + Intergenic
997965618 5:138353322-138353344 GCAACACTGGCCGAACTCTGAGG - Intronic
998568892 5:143239661-143239683 GCTTCTCTGCCCCATCCCTGTGG + Intergenic
998622172 5:143806896-143806918 GCATCTATGACCTTTCTCTGTGG + Intergenic
999327582 5:150652601-150652623 GTATTTTTGGCCAAACTCTGAGG - Exonic
1001082746 5:168679018-168679040 GCCACTCTGGCCAATGCCTGTGG - Intronic
1001673924 5:173496973-173496995 TTATCTCTGGCCAGCCTCTGTGG - Intergenic
1002035426 5:176465176-176465198 ACATATCTGGCCAGGCTCTGTGG - Intronic
1004333000 6:14738531-14738553 GCATGTCTGTGCAATCCCTGTGG - Intergenic
1007647305 6:43392805-43392827 GCATTTGGGCCCAATCTCTGGGG - Intergenic
1008657611 6:53631985-53632007 GCCTTTCTGGCCAGTCTCTATGG - Intergenic
1009045967 6:58237786-58237808 CCATTTCTGTCTAATCTCTGGGG + Intergenic
1009221782 6:60992099-60992121 CCATTTCTGTCTAATCTCTGCGG + Intergenic
1012437352 6:99228143-99228165 GCCTCTCTGGGCAGTCTCTGAGG - Intergenic
1013100355 6:106981283-106981305 CCAGCTCAGGCCATTCTCTGAGG - Intergenic
1014281655 6:119448281-119448303 GCTTCTCTGCCCAAACTGTGAGG + Intergenic
1014858877 6:126438694-126438716 GCATCTCTGGGTAGTATCTGGGG - Intergenic
1017074507 6:150605062-150605084 GCATCTCTGTCCAATAAATGAGG - Intronic
1017633624 6:156422903-156422925 CCATCCCTGGCCAATCTCCTGGG - Intergenic
1018383935 6:163285578-163285600 GCTTCTCTGGCAAATATCTCCGG - Intronic
1022110313 7:27225993-27226015 CCAGCTCTGGCCAGTATCTGAGG + Intergenic
1025250946 7:57351024-57351046 GAGTCTCTGGCCACTCCCTGGGG + Intergenic
1029663848 7:101981465-101981487 GAATGGCTGGCCACTCTCTGTGG - Intronic
1029971596 7:104795123-104795145 GCATGTCTGGCCCATCTTTCCGG - Intronic
1037024508 8:14017148-14017170 GCAGCACTGGCCAGTCTCTGTGG - Intergenic
1041133729 8:54733373-54733395 ACAGCTCTGGGTAATCTCTGTGG - Intergenic
1041421848 8:57675578-57675600 GAATCTCTTTCCAATTTCTGTGG - Intergenic
1042638643 8:70907225-70907247 TCATCTCTGCTCACTCTCTGTGG + Intergenic
1043813591 8:84773929-84773951 GCATTTCTGGCCAGTCACAGCGG + Intronic
1045877516 8:106999587-106999609 CCATCTCTGGTCAATGACTGTGG + Intergenic
1049169129 8:141147562-141147584 TCATCTCTGGTCACTCTCAGCGG + Intronic
1050391627 9:5149100-5149122 CCATCTCTGTCGAATCTCTGGGG + Intronic
1051605777 9:18916779-18916801 TCATTTCTGGCCACTCTCTCTGG + Intergenic
1053113552 9:35482405-35482427 GCAACTCTGGCAGATATCTGGGG - Intergenic
1053441553 9:38120525-38120547 GCATCACTGGCCTGACTCTGTGG + Intergenic
1054814310 9:69460410-69460432 ACATCCCTGGCCAGACTCTGGGG - Intronic
1055766607 9:79670415-79670437 GCATCTCTGGTCACTGCCTGAGG - Intronic
1057275625 9:93674710-93674732 GCCCCTCTGGATAATCTCTGGGG + Intronic
1062607470 9:137354630-137354652 GTATCCCAGGCCAAACTCTGTGG + Intronic
1185506242 X:633814-633836 GCCTCTCTGACCAAGCTCAGGGG - Intronic
1187174743 X:16886079-16886101 GCAGCACTTGCCAATTTCTGTGG + Intergenic
1187662760 X:21568568-21568590 GCCACTCTGGCCAATTTGTGAGG + Intronic
1189151180 X:38708359-38708381 GCAACTCTGGCCAGGCTCAGTGG - Intergenic
1192026524 X:67458179-67458201 GCTTCTCTGGCCTTTCTCTCTGG - Intergenic
1193251706 X:79298767-79298789 TCATCTCTGCCTAATCTCTGAGG - Intergenic
1193776778 X:85652022-85652044 GCATCTTTGGGAATTCTCTGCGG + Intergenic
1194564778 X:95471474-95471496 GTATTTCTGCCTAATCTCTGTGG + Intergenic
1194567520 X:95510833-95510855 GCAACTCTGGCAGATTTCTGTGG - Intergenic
1196104234 X:111879181-111879203 CATTCTCTGGCCAGTCTCTGAGG - Intronic
1196936979 X:120740018-120740040 GTATTTCTGGCCGATCTCTAAGG - Intergenic
1200806664 Y:7440589-7440611 GCATCTCTGGCCACTGTTTTTGG + Intergenic