ID: 962921341

View in Genome Browser
Species Human (GRCh38)
Location 3:139953245-139953267
Sequence AGGATCTGTGTGGGCATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962921341_962921354 30 Left 962921341 3:139953245-139953267 CCCTCTATGCCCACACAGATCCT 0: 1
1: 0
2: 0
3: 16
4: 202
Right 962921354 3:139953298-139953320 GGGTACTCTGTTTATTACCTGGG 0: 1
1: 19
2: 256
3: 953
4: 3410
962921341_962921353 29 Left 962921341 3:139953245-139953267 CCCTCTATGCCCACACAGATCCT 0: 1
1: 0
2: 0
3: 16
4: 202
Right 962921353 3:139953297-139953319 TGGGTACTCTGTTTATTACCTGG 0: 1
1: 16
2: 193
3: 841
4: 3364
962921341_962921351 10 Left 962921341 3:139953245-139953267 CCCTCTATGCCCACACAGATCCT 0: 1
1: 0
2: 0
3: 16
4: 202
Right 962921351 3:139953278-139953300 GGATTGAGAAACTACCTATTGGG 0: 3
1: 89
2: 582
3: 1423
4: 2386
962921341_962921350 9 Left 962921341 3:139953245-139953267 CCCTCTATGCCCACACAGATCCT 0: 1
1: 0
2: 0
3: 16
4: 202
Right 962921350 3:139953277-139953299 AGGATTGAGAAACTACCTATTGG 0: 5
1: 101
2: 458
3: 1255
4: 2142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962921341 Original CRISPR AGGATCTGTGTGGGCATAGA GGG (reversed) Intronic
900509537 1:3051951-3051973 TGGATTTGTGTGTGGATAGATGG - Intergenic
900615707 1:3564807-3564829 AGGACCTGGGTGGGCCCAGATGG - Intronic
901700245 1:11041449-11041471 AGGATGGGTGGGTGCATAGATGG + Intronic
903178072 1:21592147-21592169 AGGGTCTGTGTGTGCATGAATGG - Intergenic
904839943 1:33365968-33365990 AGGTACAGTGTGGGCACAGATGG - Intronic
905405368 1:37728826-37728848 AGGGTCTGGGTGGGGATAGAGGG + Intronic
905740182 1:40363392-40363414 GGGACCAGTGTGGGCAGAGATGG + Intronic
907546022 1:55260723-55260745 AGGACCTGTATGGGCAAAGGCGG + Intergenic
909606850 1:77516644-77516666 AAAGTCTGTGTGGGCATAGGAGG + Intronic
911190726 1:94946013-94946035 AAGATCTGTGTGGGAAAACAAGG + Intergenic
911598350 1:99822233-99822255 AGGATCTGTGTGGGGGTAGTGGG - Intergenic
914855345 1:151346530-151346552 AAGATCTCTTTGGGCATATATGG - Exonic
915452179 1:156013661-156013683 AGGGTCTGTATGGGCAGAGTGGG + Intronic
917538074 1:175888816-175888838 AGGAGTTGTGTGGGCCTGGAAGG - Intergenic
919098078 1:193060161-193060183 AGGATCTTTGTGGGAAGACAGGG + Exonic
921776840 1:219111586-219111608 AGGATCTGAGAGTGGATAGAGGG + Intergenic
922190816 1:223316854-223316876 AGGATCTGGTTGGCCAAAGAAGG + Intronic
922217412 1:223531607-223531629 AGGAGGTGTGTGTGTATAGAAGG - Intergenic
923967597 1:239159083-239159105 AGGAGGTTTGTGGGCATGGATGG + Intergenic
924410042 1:243795238-243795260 AAGATCTGTGTGGGAAAACAGGG + Intronic
1064865472 10:19873987-19874009 TGGATCTGGGTGGCCAAAGAAGG + Intronic
1066453774 10:35554683-35554705 AGGTTCTGTGAGAGCACAGAGGG + Intronic
1067941122 10:50658378-50658400 AGGCTCTGTGTGGGCAGGCAAGG + Intergenic
1068558110 10:58481616-58481638 AGGATCTGTTTGGAACTAGAAGG + Intergenic
1069535051 10:69247119-69247141 AGGATTTTTGTGGGCGTTGAAGG + Intronic
1069635687 10:69923513-69923535 GGGCTCTGTGTGGGCCTAGGAGG + Intronic
1071402802 10:85293511-85293533 AAGGCCTGTGTAGGCATAGAGGG - Intergenic
1071856628 10:89632282-89632304 AGGATCTGTGTGGCAAAAAAGGG - Intronic
1071987137 10:91063225-91063247 AGGAGCTTAGTGGGCAAAGATGG - Intergenic
1074204766 10:111273157-111273179 AGGCTGTGTGTGGTCAGAGAAGG + Intergenic
1074327633 10:112468135-112468157 AAGATCTGTGAGGGCATTGTAGG + Intronic
1076508869 10:130998311-130998333 TAGATCTGTGTGGGCAGAGAGGG + Intergenic
1076913098 10:133402131-133402153 GAGACCTGTGTGGGCACAGAGGG - Exonic
1076980268 11:200390-200412 AGGGTCTGTGTGGGGAGAGATGG + Intronic
1077983040 11:7321160-7321182 GGAATCTGTATTGGCATAGAGGG - Intronic
1077993029 11:7428993-7429015 AGGGTCTGTGTTGGAATAGGTGG + Intronic
1078582260 11:12547592-12547614 TAGATCTGTGTGGGAATAGAAGG + Intergenic
1082297634 11:50461817-50461839 AGAATCTGTGAGGGGATATATGG + Intergenic
1082302774 11:50530160-50530182 AGGATCTGTGAGGGGATACTTGG + Intergenic
1083768023 11:64851449-64851471 GGGCTCTGTGTGGCCACAGAGGG - Intergenic
1087520170 11:99223137-99223159 ATGAAGTGTGTGGGCAGAGAGGG - Intronic
1088752483 11:112856303-112856325 AGGATCAGTGTGGGAAAAGGTGG + Intergenic
1088840778 11:113625905-113625927 AGAATCTGGGTGGTCAGAGAGGG + Intergenic
1089070577 11:115696561-115696583 AGGTTCTGTGATGGGATAGATGG - Intergenic
1092213866 12:6666998-6667020 AGGGTCTTTGTAGGCAGAGAAGG + Exonic
1096434495 12:51577231-51577253 AGCATCTGTAATGGCATAGATGG - Intergenic
1096469543 12:51867632-51867654 AGGAGCAGTGTGTGCAAAGATGG - Intergenic
1097722689 12:63040765-63040787 AGAATGTGTGTAGTCATAGAGGG - Intergenic
1097868702 12:64581955-64581977 AGGATCTGTTTGAGCCTGGAAGG - Intergenic
1098602282 12:72346289-72346311 AAGATCTGTGAGAGCAGAGAGGG + Intronic
1103435901 12:120925138-120925160 AGGAACTGAGTGGGCATTGAAGG + Intergenic
1104413804 12:128581184-128581206 CGGATATGTGTGGGCTCAGACGG + Intronic
1105592954 13:21811433-21811455 TGGTGCTGTGAGGGCATAGAAGG + Intergenic
1105623073 13:22087779-22087801 AGCTCCTGAGTGGGCATAGAAGG + Intergenic
1110178389 13:72585311-72585333 TGGACATGTGTGGGGATAGATGG - Intergenic
1110889821 13:80684813-80684835 AGGACCTGGGTGGGTACAGAAGG + Intergenic
1113515267 13:110890426-110890448 TGTGTCTGTGTGAGCATAGATGG - Intronic
1121386695 14:93533758-93533780 AGGATCTTTGTGGTTATTGAAGG + Intronic
1121740907 14:96251821-96251843 AGGCCCTGTGTGGGCACAGGGGG - Intronic
1122301851 14:100735870-100735892 GGGTTCTGGGTGGGCAAAGAGGG - Exonic
1122352010 14:101101798-101101820 AGGCACTGTATGGGCAAAGATGG - Intergenic
1125467027 15:39963686-39963708 ATGATCATTGTGGGCATATAGGG + Intronic
1127780227 15:62306389-62306411 AAGATCTATGTGTACATAGACGG - Intergenic
1130797615 15:87226925-87226947 AGAAGCTGTGTGTGCATATATGG + Intergenic
1131904854 15:97132177-97132199 AGGATCTGTGATGGCACAGGAGG - Intergenic
1133560506 16:6946014-6946036 AGCATCTGTGTAGGCAAAGGGGG - Intronic
1136554864 16:31001684-31001706 AGCACCTGTGTGTGCATAGCAGG - Intronic
1136740390 16:32516367-32516389 AGGATCTGTGATGGCATATTTGG - Intergenic
1138188861 16:54998116-54998138 TGGGTCTGTATGGGCAAAGACGG - Intergenic
1139208027 16:65047922-65047944 TGGATCTGTGAGAACATAGAGGG - Intronic
1139484853 16:67249564-67249586 AGGATGTGTGGGGACATTGAGGG + Intronic
1139591599 16:67936118-67936140 AGGATCGGTGTGGGCAGGGCTGG + Intronic
1139967663 16:70754643-70754665 AGGAGCTGGGTGGGCACTGATGG - Intronic
1203029225 16_KI270728v1_random:558872-558894 AGGATCTGTGATGGCATATTTGG + Intergenic
1203042496 16_KI270728v1_random:775559-775581 AGGATCTGTGATGGCATATTTGG - Intergenic
1142668228 17:1474686-1474708 ATGGTCTGTGTGGGCAGAGCCGG + Exonic
1143142128 17:4746659-4746681 AGGATCTGTGTGGTCCCAGGAGG - Intergenic
1143953703 17:10653146-10653168 AGGATCTGTGTGGGTGGATATGG + Intronic
1147567705 17:41547855-41547877 TGGGTCTGTGTGGGGAGAGACGG - Intergenic
1148691596 17:49530275-49530297 AGGCTGTGTGTGTGCATGGAGGG - Intergenic
1149589143 17:57815584-57815606 AGGGTATGTGTGGGCATCCATGG - Intergenic
1149660946 17:58333602-58333624 AAGGTCTGTGTGGGCCTAAACGG - Intergenic
1150139773 17:62717830-62717852 AGGATCTGGGTGGGAAGAGATGG - Intronic
1152785810 17:82247393-82247415 GGGATCTTTGTGGGCAGTGAAGG - Intronic
1153333793 18:3901214-3901236 AGGAGCTGTGTAGGCAGGGAAGG - Intronic
1153919781 18:9778262-9778284 AGGAGCCGTGTGTGCATGGAGGG + Intronic
1156352210 18:36311197-36311219 AGGATGTGTCTGGGCAGGGAGGG + Intronic
1158556415 18:58478370-58478392 AAGATCTCTGTGGGCAAAGCAGG + Intergenic
1158847906 18:61463932-61463954 AGGCTCGGTGTGGGCAGAGGAGG - Intronic
1159415482 18:68142308-68142330 AGGATATGGGTGGGCAAAGAAGG + Intergenic
1161975306 19:7605208-7605230 GTGCTCTGTGGGGGCATAGAGGG - Exonic
1162158157 19:8693997-8694019 GGGGTGTGTGTGGGCATGGAGGG + Intergenic
1162530012 19:11230533-11230555 AGAATGTGTGTGGCCAGAGAAGG + Intronic
1164359945 19:27494800-27494822 AAGATCTGTGTGGGTATATTTGG + Intergenic
1164360001 19:27495641-27495663 AGGATCTGTGAAGGCATATTTGG + Intergenic
1164362597 19:27531983-27532005 AGAATCTGTGAAGGCATATATGG + Intergenic
1164725793 19:30464856-30464878 AGGTTCTGTGGAGGCCTAGAGGG + Intronic
1165133038 19:33645146-33645168 AAGATGAGTGTGGGCAGAGAGGG + Intronic
1165735534 19:38173328-38173350 AGCATCTGTGAGGTCATCGATGG - Intronic
1168609308 19:57786543-57786565 AGGGTCTGTGTGGGGATGGCGGG - Intronic
925359857 2:3270226-3270248 AGCACCCGTGTGGGCACAGATGG - Intronic
925776076 2:7337609-7337631 AGGACCTGTGTGGACTTTGAGGG + Intergenic
926940112 2:18126638-18126660 AGGGTCTGGGTGGGAATAGAGGG + Intronic
927468540 2:23354995-23355017 TGTATCTGTGTGGGCATGCATGG - Intergenic
927674272 2:25093037-25093059 TGGAGCTGAGAGGGCATAGAAGG - Exonic
928087683 2:28356082-28356104 AGCATCTGTGTGGAGATGGAAGG - Intergenic
929730540 2:44486754-44486776 AGGATTTGTGGGAACATAGAAGG - Intronic
931634311 2:64328061-64328083 AGGAGCCGTGTGGGCAGAGAAGG - Intergenic
934603205 2:95674324-95674346 AGGAGCTGTGTGGGCTAAAAAGG + Intergenic
935712169 2:105908991-105909013 AGGCTCTGTGTGGGCCCTGAAGG + Intergenic
936043237 2:109165731-109165753 AGGATCTGAGTGGGGAGAGTGGG - Intronic
936536587 2:113316530-113316552 AGGAGCTGTGTGGGCTAAAAAGG + Intergenic
938065665 2:128280772-128280794 AGGTGCTGTGTGGGCACAGGGGG + Intronic
938630809 2:133165136-133165158 AGGCTCTGTCTGTGCATTGATGG - Intronic
941674008 2:168324666-168324688 AGGATCTGAATGGGCAGAAAGGG + Intergenic
945664020 2:212719950-212719972 ATAATCTGTGTTGGCATAAAGGG + Intergenic
945982174 2:216321493-216321515 AGGAACTGAGTTGGCAAAGAGGG + Intronic
948844694 2:240677465-240677487 AGGACCAGTGTGGGCCTGGAGGG - Intronic
948849166 2:240697414-240697436 AGGACCAGTGTGGGCCTGGAGGG + Intronic
1170946349 20:20894590-20894612 AGCATCTGTGTGGCCACAAAAGG - Intergenic
1171120734 20:22567313-22567335 ACCATCTGTATGTGCATAGAAGG - Intergenic
1172956638 20:38764523-38764545 AGGTTCATTGTGGTCATAGAGGG + Intronic
1175146585 20:56901098-56901120 GGGAGGTGTGTGGGCATAGCGGG + Intergenic
1176985965 21:15436554-15436576 AGGATCAGGGTGGGCACAGCAGG - Intergenic
1181623658 22:24107580-24107602 AGGAACTGTGTGGGCAAGAAAGG - Intronic
1182112712 22:27734648-27734670 AGGATCTGTGTGTGCAGAAGTGG - Intergenic
1184590212 22:45476979-45477001 AGGAGTTCTGTGGGCAGAGATGG - Intergenic
1184610034 22:45597562-45597584 AGGGTCAGTGTGGGCTTACAGGG - Intronic
949783979 3:7720399-7720421 AGGATTTGTTTGGGCTTGGAGGG - Intronic
950447280 3:13045597-13045619 AGGATGTGTGGGGGCCTAGCAGG - Intronic
950881737 3:16328023-16328045 ATGAACTATGTGGGCATACAGGG - Intronic
955479013 3:59370170-59370192 AGGAGCTGTGAGGGCATGCATGG - Intergenic
962343322 3:134602702-134602724 AGGCTCTGTGAGGGCCTGGAGGG + Intronic
962921341 3:139953245-139953267 AGGATCTGTGTGGGCATAGAGGG - Intronic
962985549 3:140532872-140532894 AGAATTTGTGTGGGGATAAAGGG - Intronic
964412477 3:156413172-156413194 AGGGTCTGAGTGGGGATAGAAGG + Intronic
966320785 3:178699205-178699227 AGGATCACTCAGGGCATAGAAGG + Intronic
966639611 3:182175113-182175135 CCTATCTGTTTGGGCATAGAAGG - Intergenic
967945749 3:194802397-194802419 AGGATCTGGGTGAGGATGGAGGG - Intergenic
967986099 3:195096280-195096302 AGGATCTGTGTGGCCAGACGGGG + Intronic
968492464 4:897486-897508 AGGCTACGTGTGGGCAGAGACGG + Intronic
969491634 4:7502507-7502529 AGGAGCTGTGTGGACATGGCTGG + Intronic
969599147 4:8165633-8165655 AGCTGCTGTGTGGGCATGGAAGG + Intergenic
969711614 4:8847587-8847609 AGCATCTCTGTGGGGACAGAAGG - Intronic
970081635 4:12293725-12293747 AAGATTTCTGTGGGCATAGTTGG + Intergenic
971262612 4:25070713-25070735 AGGACCTGTGGGGGCAGGGAAGG - Intergenic
980693308 4:136323700-136323722 AGGATGTGTGTGTGGAGAGAGGG + Intergenic
981867003 4:149434638-149434660 TGGATCTGTGAGGCAATAGATGG - Intergenic
981909917 4:149967238-149967260 TGGTTGTGTGTGTGCATAGAGGG - Intergenic
983290340 4:165795292-165795314 AGTATGTGTGTGGGGAGAGATGG - Intergenic
985211272 4:187598092-187598114 AGGATTTGTGTTTTCATAGATGG - Intergenic
986004999 5:3660203-3660225 AGGTTCTGTGTGGTCATAACAGG - Intergenic
990203290 5:53402034-53402056 AGATTTTGTGTGGGCATAGCTGG - Intergenic
991403413 5:66277688-66277710 GGGATCTATGTGGGCAGAGGGGG - Intergenic
996851534 5:127958466-127958488 AGGACCTTTGTGTGCATAGTGGG - Intergenic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
1000108310 5:158082187-158082209 AGAGTCTGAGTGGGCATAGTTGG + Intergenic
1000872182 5:166590728-166590750 AGGATCTGGGTGGAGAAAGAGGG - Intergenic
1004313534 6:14566337-14566359 AGGTTCTGTGTTGGCAGAAATGG - Intergenic
1005691963 6:28315271-28315293 ATTATCTTTGAGGGCATAGAAGG - Intergenic
1006203241 6:32315885-32315907 AGGACTTGTGTGGGCAAAGAAGG + Intronic
1006246622 6:32742752-32742774 AGGAACAGTGTGGGCAGTGAAGG + Intronic
1007386220 6:41521950-41521972 AGGAATTGTGTGGGCAGAGGTGG + Intergenic
1008975313 6:57419220-57419242 AGGATCTTGGTGGCCATTGATGG + Intronic
1009164192 6:60320733-60320755 AGGATCTTGGTGGCCATTGATGG + Intergenic
1009918865 6:70031199-70031221 ATGATCTGTGTGGGGGCAGAGGG - Intronic
1017455475 6:154597487-154597509 AGGATGGGTGTGGACAGAGAAGG - Intergenic
1018451639 6:163913946-163913968 AGTATGTGTGTGGGCATTCATGG + Intergenic
1018468899 6:164079515-164079537 GGGTTCTGTGTGGCCATGGAGGG - Intergenic
1018926615 6:168211217-168211239 AAGACCTGTGTGGGCACAGCAGG + Intergenic
1019067421 6:169313869-169313891 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1019067439 6:169314041-169314063 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1019067454 6:169314173-169314195 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1019067494 6:169314533-169314555 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1019067529 6:169314814-169314836 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1019067546 6:169314945-169314967 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1021130664 7:16908863-16908885 AGAATTTGTGTGTGCATAGTAGG + Intergenic
1024047087 7:45592316-45592338 AGACTCTGTGAGGGCACAGAGGG - Intronic
1025530275 7:61871775-61871797 AGGATCTGTGATGGCATATTTGG - Intergenic
1028013721 7:85681037-85681059 AGAAGCTCTGTGTGCATAGATGG + Intergenic
1029054269 7:97724026-97724048 AGGATGTGTGTGGAGAAAGAGGG + Intergenic
1031289854 7:119920145-119920167 AGGATCTGTGTGGCCTGAAATGG + Intergenic
1031390083 7:121203206-121203228 GGGATCTGTGAAGGTATAGAAGG - Intronic
1032394819 7:131581751-131581773 AGGATGTGTGTGTGCATTGTTGG - Intergenic
1035456396 7:159011727-159011749 AGGAGCTGTGTGGGCAAAGGTGG - Intergenic
1037181715 8:16014858-16014880 AGTGTCTGAGTGGACATAGAGGG + Intergenic
1042601477 8:70503376-70503398 AGGATAGGTGGGGGCATAGTGGG + Intergenic
1043263515 8:78232000-78232022 AGGAGCTGTGGGGGCAGTGAGGG - Intergenic
1047011782 8:120680481-120680503 AAGACCTGTGTGGACATATAAGG - Intronic
1049417022 8:142499942-142499964 AGGAACCGGGTGGGCATTGAGGG - Intronic
1049758808 8:144322636-144322658 AGGAACTGTGTAGGTGTAGATGG - Intronic
1053346048 9:37378870-37378892 AGGATTTGGCTGGGCAGAGACGG - Intergenic
1053477139 9:38390734-38390756 AGGATCTGTGGGGTCCTAGAAGG - Intergenic
1053483681 9:38435784-38435806 AGCATCTCTGTGTGCCTAGAAGG + Intergenic
1054232850 9:62531241-62531263 AAGATTTGTGTGTGGATAGATGG + Intergenic
1055727159 9:79242933-79242955 ATGATGTGTGTGTGCATGGATGG + Intergenic
1055949618 9:81718781-81718803 AAGAACTGTGTGGGCATTGAAGG + Intergenic
1056331634 9:85525947-85525969 AGGTGCTGTGTGGGCATGGGAGG - Intergenic
1057408836 9:94798343-94798365 AGAATCTCTCTGGGCATAAAAGG - Intronic
1059599136 9:115757268-115757290 AAGATCTATGTGGGTATAAATGG + Intergenic
1060676620 9:125520985-125521007 AGGATATGTGTTGGGATAGGTGG - Intronic
1060712086 9:125877143-125877165 AGGATCTGTGTGTGCCTCTAGGG - Intronic
1061382615 9:130267309-130267331 AGGCTCTCGGTGGGCATAGGCGG - Intergenic
1061574916 9:131500331-131500353 AGAAGCTGTGTGGGTAGAGAAGG + Intergenic
1061726688 9:132585972-132585994 AGGATATGTGTTGGAATAGGGGG - Intronic
1062328422 9:136023822-136023844 AGGGTCTGTGTGTGCTGAGAAGG + Intronic
1185511774 X:669134-669156 AGGGCCTGTGGGGGGATAGAAGG - Intergenic
1185835301 X:3340200-3340222 AACAGCTGTGTGGGAATAGAAGG + Intronic
1186277513 X:7956092-7956114 GGGAGCTGTGTGTGCATATAAGG - Intergenic
1186780176 X:12904264-12904286 AAGATCTGTGTCAGCATGGATGG + Intergenic
1189890320 X:45594672-45594694 ATGATATGTGTGAGCATGGATGG + Intergenic
1191783748 X:64895422-64895444 AGGATCTAGGTGGGAATATATGG - Intergenic
1192235822 X:69295343-69295365 AGAACATGTGTGGGCACAGATGG + Intergenic
1192580100 X:72273929-72273951 AAGATCTTTGTGGGCACAAAAGG - Exonic
1196097423 X:111815090-111815112 AGGATATCTCTGGGCAGAGATGG + Intronic
1198320079 X:135511687-135511709 AGGTTCTATGTGAGCACAGAAGG - Intergenic
1199947925 X:152682418-152682440 AGGTCCTGAGTGAGCATAGAAGG + Intergenic
1199961754 X:152786036-152786058 AGGTCCTGAGTGAGCATAGAAGG - Intergenic
1201943476 Y:19484146-19484168 AGGATAGGTGTGGGAATTGATGG + Intergenic