ID: 962921342

View in Genome Browser
Species Human (GRCh38)
Location 3:139953246-139953268
Sequence GAGGATCTGTGTGGGCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962921342_962921350 8 Left 962921342 3:139953246-139953268 CCTCTATGCCCACACAGATCCTC 0: 1
1: 0
2: 1
3: 18
4: 221
Right 962921350 3:139953277-139953299 AGGATTGAGAAACTACCTATTGG 0: 5
1: 101
2: 458
3: 1255
4: 2142
962921342_962921354 29 Left 962921342 3:139953246-139953268 CCTCTATGCCCACACAGATCCTC 0: 1
1: 0
2: 1
3: 18
4: 221
Right 962921354 3:139953298-139953320 GGGTACTCTGTTTATTACCTGGG 0: 1
1: 19
2: 256
3: 953
4: 3410
962921342_962921351 9 Left 962921342 3:139953246-139953268 CCTCTATGCCCACACAGATCCTC 0: 1
1: 0
2: 1
3: 18
4: 221
Right 962921351 3:139953278-139953300 GGATTGAGAAACTACCTATTGGG 0: 3
1: 89
2: 582
3: 1423
4: 2386
962921342_962921353 28 Left 962921342 3:139953246-139953268 CCTCTATGCCCACACAGATCCTC 0: 1
1: 0
2: 1
3: 18
4: 221
Right 962921353 3:139953297-139953319 TGGGTACTCTGTTTATTACCTGG 0: 1
1: 16
2: 193
3: 841
4: 3364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962921342 Original CRISPR GAGGATCTGTGTGGGCATAG AGG (reversed) Intronic
900141650 1:1141407-1141429 AAGGATGTGGGTGGGGATAGAGG - Intergenic
902697339 1:18149226-18149248 GAGGGTGTGTGTGGCCATGGTGG + Intronic
902728328 1:18351958-18351980 GAGGATCTGCATGGGCCTAGAGG + Intronic
903479823 1:23645087-23645109 GAGGAGCTGTGGGGGCAGGGAGG - Intergenic
904747602 1:32720609-32720631 GAGGCTCAGTGAGGGGATAGGGG + Intergenic
905405367 1:37728825-37728847 GAGGGTCTGGGTGGGGATAGAGG + Intronic
906078140 1:43067156-43067178 GAAGATCAGTATGGGCAAAGTGG + Intergenic
907289062 1:53401271-53401293 GAGGAGCTGTGAGGGTGTAGGGG + Intergenic
910735844 1:90456513-90456535 AAGGAACTGTCTGGGCACAGTGG + Intergenic
911018211 1:93357984-93358006 GAGATTCTGGCTGGGCATAGTGG + Intronic
911546574 1:99224746-99224768 CAGGCTCTGTGTGGGCCTTGTGG + Intergenic
911598351 1:99822234-99822256 CAGGATCTGTGTGGGGGTAGTGG - Intergenic
915446221 1:155976388-155976410 GTGGATCTGAGAGGGCAAAGAGG - Intronic
915452178 1:156013660-156013682 TAGGGTCTGTATGGGCAGAGTGG + Intronic
917938042 1:179888424-179888446 GAGACCCTGTCTGGGCATAGTGG - Intronic
918384308 1:183989936-183989958 GAGGATCTGTGTGTGTGTTGGGG - Intronic
920020353 1:202951035-202951057 AAGGATCTGTGGTGGCACAGGGG - Exonic
920169602 1:204063216-204063238 GAGGATCCCTTTGGGCAGAGAGG + Intergenic
920971787 1:210749146-210749168 GAGGGGCTGGGTGGACATAGTGG - Intronic
922601626 1:226859631-226859653 CAGGGTCTGTGTGGGCAAAATGG + Intergenic
923139988 1:231152985-231153007 GAGGGTGTGTGTGGGGAAAGGGG + Intergenic
1063375910 10:5554064-5554086 GAGGATCTGTGGGGGAGCAGGGG - Intergenic
1064097798 10:12436687-12436709 GGGCATCTGTGTGGGCATGCTGG + Intronic
1065963912 10:30755330-30755352 GGGAATGTGTGTGGGCAGAGAGG - Intergenic
1068097997 10:52516072-52516094 GAGCATCTGTGTGGACATTGTGG - Intergenic
1069161279 10:65095293-65095315 GAGGATATGCATGGGCATAATGG + Intergenic
1070438023 10:76412735-76412757 GAGGATGTTTGTGGGCATAGGGG - Intronic
1070611483 10:77936150-77936172 GAGAATCTGGCTGGGCATGGTGG + Intergenic
1073855295 10:107666522-107666544 GAGGATACGTGTGGCCACAGTGG - Intergenic
1073977796 10:109119983-109120005 GAGGATGTGTATAGGCAGAGTGG - Intergenic
1075560473 10:123464558-123464580 GAGGCTCAGTGTGGCCAAAGTGG - Intergenic
1075819937 10:125298412-125298434 GAGGATCTGGGTGGCCAGGGTGG - Intergenic
1076508868 10:130998310-130998332 ATAGATCTGTGTGGGCAGAGAGG + Intergenic
1077414778 11:2420017-2420039 GAGGAGCTGTCTGGGCAGAGTGG - Intronic
1077960951 11:7076528-7076550 GAGGAGCTGAGTGGCCAGAGAGG - Intergenic
1078001504 11:7500390-7500412 GAGGATCTGGGTGTGCAGAAGGG - Intronic
1081019179 11:37922045-37922067 GTTGAGCTGTGTGGGCAAAGAGG - Intergenic
1082281858 11:50278975-50278997 GAGGATCTGGGTGGGCAGGGAGG + Intergenic
1083455961 11:62778768-62778790 GTGGATGTGTGTGGGGATGGTGG + Intronic
1084198579 11:67540673-67540695 GAGGGGCTGGGTGGGCATAAGGG + Intergenic
1086526834 11:87737820-87737842 CAGGATCTGTCTGGGAATATAGG - Intergenic
1087520171 11:99223138-99223160 GATGAAGTGTGTGGGCAGAGAGG - Intronic
1088254396 11:107889321-107889343 GAAGTTCTGTCTGGGCACAGTGG + Intronic
1088840777 11:113625904-113625926 GAGAATCTGGGTGGTCAGAGAGG + Intergenic
1090369478 11:126238350-126238372 GAGAATCTGTGTGTACATAAGGG + Intronic
1090399217 11:126438077-126438099 GAGCATCTTTCTGGGCAAAGTGG + Intronic
1090605138 11:128414625-128414647 AAGGATTTGTGTGGCTATAGGGG + Intergenic
1091428820 12:414821-414843 AAGGGTCTGTGTGAGCATCGTGG - Intronic
1092280046 12:7091786-7091808 GAGGTTCAGGGTGGGCAGAGAGG - Intronic
1092496236 12:8998038-8998060 GAGGAATTGGCTGGGCATAGTGG + Intronic
1096522654 12:52192995-52193017 GAGGCTCTGTGGGGGCAAAATGG - Intergenic
1099439844 12:82686831-82686853 GAGGATCTGGGTGGAGAAAGGGG + Intergenic
1104662259 12:130619888-130619910 CAGTAACTGTGTGGGCAAAGAGG + Intronic
1106499605 13:30315329-30315351 GAGGACATGTGTAGGCACAGAGG - Intergenic
1107169059 13:37317689-37317711 GAGGAACTGTGTGAGCCTTGGGG + Intergenic
1111982043 13:95026599-95026621 AAAGATCTGGCTGGGCATAGTGG + Intronic
1113188878 13:107720995-107721017 AAGGCTCTCTGTGGGCATCGTGG + Intronic
1113279122 13:108769347-108769369 GAAGATCTGTGTGGCCAGAATGG + Intronic
1113755972 13:112811265-112811287 GAGGGTGTGTGTGGGGATGGGGG - Intronic
1113755992 13:112811341-112811363 GAGGCTGTGTGTGGGGATGGGGG - Intronic
1118435839 14:65770300-65770322 GAGGATCTGTGTGGGCTGAAGGG + Intergenic
1119557178 14:75562269-75562291 GAGGACCTGTGTCAGCACAGTGG + Intergenic
1121626188 14:95387099-95387121 GAGGGTGTGTGTGTGCAGAGGGG - Intergenic
1121626200 14:95387153-95387175 GAGGGTGTGTGTGTGCAGAGGGG - Intergenic
1121740908 14:96251822-96251844 CAGGCCCTGTGTGGGCACAGGGG - Intronic
1121755548 14:96399407-96399429 GAGCATATGTGTAGGTATAGAGG - Intronic
1122301852 14:100735871-100735893 GGGGTTCTGGGTGGGCAAAGAGG - Exonic
1122793645 14:104194993-104195015 GAGGGTCTGCGTGTGCAGAGTGG - Intergenic
1123438918 15:20275775-20275797 GAATCTCTGTGTGTGCATAGTGG + Intergenic
1124186640 15:27535827-27535849 GAGGAGCAGTGTGGGGAGAGTGG + Exonic
1128535823 15:68489489-68489511 CAGGCTCTGTTTGGGCAGAGAGG - Intergenic
1128920140 15:71603042-71603064 CAGGACCTGTGAGGGCTTAGCGG + Intronic
1129060298 15:72855783-72855805 GAGGATCAGTGAGGACATGGAGG + Intergenic
1133560507 16:6946015-6946037 AAGCATCTGTGTAGGCAAAGGGG - Intronic
1135078594 16:19414889-19414911 GAGAAACTAGGTGGGCATAGTGG + Intronic
1135120411 16:19761442-19761464 GTGGATCTGGATGGGCAAAGAGG + Intronic
1136846244 16:33578535-33578557 GAATCTCTGTGTGTGCATAGTGG - Intergenic
1138686350 16:58729372-58729394 GATGGTCTGGCTGGGCATAGTGG + Intronic
1139346187 16:66305329-66305351 GAGCAACTGTGAGGGCATGGAGG - Intergenic
1139473884 16:67192865-67192887 GTGGAAGTGAGTGGGCATAGTGG + Exonic
1139484852 16:67249563-67249585 GAGGATGTGTGGGGACATTGAGG + Intronic
1139583745 16:67887994-67888016 CAGGAGCTGTGTGGACCTAGAGG - Intronic
1139958204 16:70703347-70703369 CAGGGTCTGGGAGGGCATAGGGG + Intronic
1140550155 16:75856594-75856616 CAGGATCTGTGTGGGCCCTGAGG - Intergenic
1141712538 16:85708326-85708348 CAGGACCAGTGGGGGCATAGGGG - Intronic
1142205389 16:88780374-88780396 GAGGATGTGGGTGGGGGTAGGGG + Intronic
1203107952 16_KI270728v1_random:1427189-1427211 GAATCTCTGTGTGTGCATAGTGG - Intergenic
1203145586 16_KI270728v1_random:1795920-1795942 AAGGGTCTGTGTGGGCACAAGGG - Intergenic
1143473440 17:7190406-7190428 GTGGGTCTGTGTGTGCATTGGGG + Exonic
1145722216 17:27083655-27083677 GGCTGTCTGTGTGGGCATAGTGG + Intergenic
1147043685 17:37737044-37737066 GAGGTTCTGTGTGTGTAGAGGGG + Intronic
1148129722 17:45255533-45255555 GAGGAGCTGAGTGGGCATCAGGG + Exonic
1148257353 17:46146914-46146936 GAAGATCTGGCTGGGCACAGTGG + Intronic
1151390250 17:73782154-73782176 AAGACTCTGTGTGGTCATAGGGG + Intergenic
1151594577 17:75069553-75069575 CAGGTTCTGGCTGGGCATAGTGG - Intergenic
1153204303 18:2680488-2680510 GAGGGGCTCTGTGTGCATAGTGG + Intronic
1153780771 18:8493406-8493428 GAGGATCTGAGTGGGGTAAGGGG - Intergenic
1156370152 18:36465757-36465779 GAGGCTGTGTGTGGGCGTGGTGG + Intronic
1157291791 18:46414925-46414947 GAGGATGTGTGAGGGAGTAGGGG + Intronic
1157839080 18:50938038-50938060 AAGGATCTGGCTGGGCACAGTGG + Intronic
1160156599 18:76438911-76438933 GAGTGTCTGTGTGGGAATTGAGG - Intronic
1162158156 19:8693996-8694018 GGGGGTGTGTGTGGGCATGGAGG + Intergenic
1162871000 19:13586638-13586660 AAGGATCAGTTTGGGCACAGTGG + Intronic
1163795224 19:19334156-19334178 GAGGCTGTGTGTGGGGACAGTGG - Intronic
1164794593 19:31015592-31015614 GTGGAACTGTGTGGGCAGAAGGG + Intergenic
1164794622 19:31015721-31015743 GTGGAGCTGTGTGGGCAGAAGGG + Intergenic
1165034888 19:33025607-33025629 GAATCTCTGTGTGTGCATAGTGG + Intronic
1165133037 19:33645145-33645167 GAAGATGAGTGTGGGCAGAGAGG + Intronic
1165144037 19:33720161-33720183 GAGGGACTGTGTGGGCCTGGTGG + Intronic
1165174365 19:33916538-33916560 GGGTATCTGTGTGGGAACAGGGG + Intergenic
1165500064 19:36181827-36181849 AAGGTTCTGGCTGGGCATAGTGG - Intergenic
1165618769 19:37226478-37226500 GAGGATCAGTCAGGGCACAGAGG - Exonic
1165763230 19:38334876-38334898 GAGTCTCTGGCTGGGCATAGTGG - Intergenic
1166137537 19:40786481-40786503 GAAGAGCTGGGTGGGCATATCGG + Intronic
1166881974 19:45935239-45935261 GAGAATCTGTGGGGTCATGGTGG - Exonic
1166910428 19:46151073-46151095 GAGGATTGGTGTGGGCAGATGGG - Intronic
1167208687 19:48119473-48119495 GAGGATGTGGGTGAGCATAAGGG - Intronic
1168609309 19:57786544-57786566 CAGGGTCTGTGTGGGGATGGCGG - Intronic
925363457 2:3295424-3295446 GAGGGTGTGTGTGTGCAGAGAGG - Intronic
925363603 2:3296132-3296154 GAGGGTGTGTGTGTGCAGAGAGG - Intronic
925776075 2:7337608-7337630 GAGGACCTGTGTGGACTTTGAGG + Intergenic
926206387 2:10836915-10836937 GATGAGCTGTGTGAGCACAGAGG + Intronic
926940111 2:18126637-18126659 AAGGGTCTGGGTGGGAATAGAGG + Intronic
927895113 2:26776479-26776501 GAGGGTGTGTGTGGGCACAGGGG + Exonic
930013115 2:46952787-46952809 GAGGATGGGTGTGGGCATGAGGG - Intronic
931437642 2:62262829-62262851 GCGGATTTGTGTGGAAATAGTGG - Intergenic
933647164 2:84822165-84822187 GAGAAGCTGTGTGGGCATTTGGG - Intronic
934607522 2:95708396-95708418 GAGACTCTGTGTGGGAATGGAGG - Intergenic
934712340 2:96524178-96524200 GAGGATCTTTGTGGGGATTTGGG - Intergenic
936043238 2:109165732-109165754 AAGGATCTGAGTGGGGAGAGTGG - Intronic
936048516 2:109204918-109204940 GAGCAACTGGGTGGGCATGGTGG + Intronic
937087641 2:119181844-119181866 GAGGAGCTCTGTGGGCCTTGAGG - Intergenic
937352014 2:121171920-121171942 CAGGAACTGTGGGGGCAGAGAGG - Intergenic
938065664 2:128280771-128280793 CAGGTGCTGTGTGGGCACAGGGG + Intronic
938906664 2:135843133-135843155 GAGGAGCTGTGAGGGGAGAGTGG + Intronic
940954712 2:159714412-159714434 GTGGTTCTGTGGGAGCATAGGGG + Intronic
942083741 2:172426135-172426157 CAGGAGCTGTGTGTGCATAGGGG - Intergenic
942569309 2:177297322-177297344 TAGGACCTGTCTTGGCATAGAGG - Intronic
943547656 2:189300897-189300919 GATGATCTGGCTGGGCATGGTGG + Intergenic
946252811 2:218423856-218423878 GAGGCCCTGTCTGGGCATGGGGG + Intronic
946391756 2:219420416-219420438 GAGGCTCTGGCTGGGAATAGGGG + Intronic
946558754 2:220889366-220889388 GAGGTTCTCTGTAGGGATAGGGG + Intergenic
947568173 2:231209188-231209210 GAGGTTCTGGCTGGGCATGGTGG - Intronic
947574223 2:231259703-231259725 GAGGATTTGGCTGGGCATGGTGG + Intronic
948411205 2:237762706-237762728 GAAGGACTGTGTGGACATAGAGG + Exonic
948710128 2:239820126-239820148 GAGGCTCTGTCTGGGGACAGTGG + Intergenic
949035652 2:241814701-241814723 GGGGCTCTGTGTGGGTGTAGTGG + Intronic
1168856407 20:1012436-1012458 GAGGAGCTGTGGGAGCCTAGGGG + Intergenic
1169179357 20:3549760-3549782 GAGAATATGTGTTGTCATAGTGG + Intronic
1172505663 20:35460431-35460453 GAGAATCGGTGTGTGCATAGGGG + Intronic
1175146584 20:56901097-56901119 AGGGAGGTGTGTGGGCATAGCGG + Intergenic
1175265993 20:57703838-57703860 GAGCAGCTGTGTGTTCATAGAGG - Intronic
1175277974 20:57784796-57784818 GAGGCTCTGTGGGGCCATTGTGG - Intergenic
1177710266 21:24764702-24764724 GTGGATCTGTGTGGCCCAAGTGG + Intergenic
1182854090 22:33501903-33501925 GAGGAACTGGGTGGGCATGATGG + Intronic
1183156052 22:36076202-36076224 GAGGCTCTGTGTGGTGAGAGTGG - Intergenic
1183677087 22:39305414-39305436 GATAATCTGGCTGGGCATAGTGG - Intergenic
1183876413 22:40786021-40786043 GAGGTTCTGGCTGGGCACAGTGG + Intronic
1184561755 22:45268063-45268085 GAGGATCTGTGGGAGCTGAGTGG + Intergenic
952084687 3:29803461-29803483 GAGGAGATGTGTGGACAAAGGGG + Intronic
952405750 3:33003740-33003762 TAGAATCTGTCTGGGCATGGTGG + Intronic
953838694 3:46370384-46370406 GAGCATCTGTGTGGGGGTTGGGG + Intergenic
954375505 3:50192274-50192296 GTGGATCTGGGTGGTCCTAGAGG - Intronic
954447450 3:50554280-50554302 GAGGAACTGGGTGGTCAGAGGGG - Intergenic
955756133 3:62227039-62227061 GGGGATTTGTGTTGGCATAATGG + Intronic
962320925 3:134389569-134389591 GAGGGGCTGTGTGGGCCCAGGGG - Intergenic
962921342 3:139953246-139953268 GAGGATCTGTGTGGGCATAGAGG - Intronic
962923972 3:139975045-139975067 GAGGAGCTGTGTGTGCAGACAGG + Intronic
967945750 3:194802398-194802420 GAGGATCTGGGTGAGGATGGAGG - Intergenic
967986098 3:195096279-195096301 GAGGATCTGTGTGGCCAGACGGG + Intronic
969329272 4:6463675-6463697 GAGGAACGGTGTGTGCAAAGTGG - Intronic
971048547 4:22832748-22832770 CTGGTTCTATGTGGGCATAGTGG - Intergenic
971432514 4:26583328-26583350 AAGGAACTGTGTGGGCACAAAGG - Intronic
972116728 4:35645047-35645069 AAGGATATATGTGGGCATAATGG + Intergenic
972798488 4:42447108-42447130 GAGGATCTGGCTGAGTATAGGGG + Intronic
974713908 4:65640676-65640698 GAGGGTCTGTGTGTGCATGTTGG + Intronic
982983099 4:162165875-162165897 GATGATCTGTGGGGGCAGATGGG + Intergenic
983209773 4:164946559-164946581 GGAGATTTGTGTGGCCATAGAGG + Intergenic
989188323 5:38645857-38645879 GAGGATCTATGTGGGATGAGGGG - Intergenic
991403414 5:66277689-66277711 TGGGATCTATGTGGGCAGAGGGG - Intergenic
992341541 5:75828980-75829002 GAGAGTCTGTGTGGGCACAGAGG - Intergenic
992489871 5:77232024-77232046 GTGGATGTGGATGGGCATAGTGG + Intronic
992578182 5:78141779-78141801 GATGATTTTTGTGGGCATTGAGG - Intronic
994125495 5:96165307-96165329 GAGGATATATGTGTGCAGAGGGG + Intergenic
994430997 5:99661139-99661161 GTGTACCTGTGTGTGCATAGGGG + Intergenic
996851535 5:127958467-127958489 AAGGACCTTTGTGTGCATAGTGG - Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
1002917559 6:1541548-1541570 GAGGACCTGGGTGGGCACAGTGG + Intergenic
1003430768 6:6035467-6035489 GAGGATTTGAGTGGGTGTAGAGG + Intergenic
1004064072 6:12225947-12225969 AATGATCTGTGTGCTCATAGGGG - Intergenic
1004494443 6:16150508-16150530 GAGGCCCTGTGTAGGCATAGAGG + Intergenic
1006060296 6:31414115-31414137 GAGGTTCTGTGTGGAGATGGTGG + Intronic
1007680878 6:43632544-43632566 CTGGATCTGGCTGGGCATAGTGG - Intronic
1007898514 6:45387463-45387485 AAGAATCTGTGTGGGCACAGCGG + Intronic
1010760006 6:79711770-79711792 GAGAATCTGTGTTGGCAAGGAGG + Intergenic
1013589442 6:111607956-111607978 GTGGCTCTGTCTGGGCATAACGG - Intergenic
1014589061 6:123239124-123239146 GAGTATATGGCTGGGCATAGTGG - Intronic
1014973984 6:127855736-127855758 GAGTATCTTTGTGGCGATAGGGG + Intronic
1016263730 6:142207193-142207215 GATTTTCTGTGTGGGCATAAGGG - Intronic
1017765751 6:157605784-157605806 GAGACTCTGCGTGGGCACAGCGG + Intronic
1017825461 6:158078368-158078390 AAGGATGTGTGTGCGCATGGGGG + Intronic
1018369602 6:163155814-163155836 GAGGATGTGCGTGGGCACAAAGG - Intronic
1018468900 6:164079516-164079538 GGGGTTCTGTGTGGCCATGGAGG - Intergenic
1018646679 6:165955103-165955125 GTGGATCAGTGGTGGCATAGAGG - Intronic
1020117985 7:5487120-5487142 GGGCACCTGTGTGGGCCTAGGGG - Intronic
1022649870 7:32264883-32264905 AAGGATCTGTTTGGGCATTTTGG - Intronic
1022942159 7:35251287-35251309 CATGATGTGTGTGGGCATATGGG + Intronic
1023344096 7:39253303-39253325 GAGGACCTGTGTGCTCACAGAGG + Intronic
1025107135 7:56180811-56180833 GGGGATCTGGATGGGCATGGTGG + Intergenic
1026111605 7:67462916-67462938 GATGATTTGTGAGGGCAGAGCGG + Intergenic
1027425018 7:78053459-78053481 GAGGACCTGTGTGGACAGACTGG + Intronic
1030411590 7:109188142-109188164 GAGGATCAGTTTGGGCATATGGG + Intergenic
1033943163 7:146681113-146681135 GAGGATCAGTGTTGGCTTAGGGG + Intronic
1034882962 7:154776357-154776379 GAGGAGCTCTCTGGGCAGAGGGG - Intronic
1035110940 7:156481209-156481231 CAGGAGCTGGGTGGCCATAGCGG - Intergenic
1037205400 8:16312101-16312123 GAGCATCCATGTTGGCATAGGGG - Intronic
1038421968 8:27439290-27439312 GAGGCTTTGGGTGGGCAAAGAGG - Exonic
1041020661 8:53634999-53635021 AAGGATTTGTGGGGGCAGAGAGG - Intergenic
1041494012 8:58465967-58465989 CAGGATCTGTGTGAGCAAAAAGG - Intergenic
1042601476 8:70503375-70503397 CAGGATAGGTGGGGGCATAGTGG + Intergenic
1045025082 8:98079362-98079384 CAAGATCTGGGTGGGCACAGGGG - Intronic
1045470561 8:102508710-102508732 GAGGGGCTGTGTGGGGAAAGGGG + Intergenic
1047360711 8:124166354-124166376 GAAGAGCTATGTGGGCACAGAGG + Intergenic
1050098979 9:2098560-2098582 GAGAGAGTGTGTGGGCATAGAGG + Intronic
1050494946 9:6230732-6230754 GAGGATCTATGAGGATATAGTGG - Intronic
1051235474 9:14993967-14993989 TAGGAGATGTTTGGGCATAGTGG + Intergenic
1051795566 9:20865457-20865479 GAGGAACTGTGTGGGCTCTGTGG + Intronic
1060427025 9:123514519-123514541 GAGCATCTGGGTGGGGATGGAGG + Intronic
1060803351 9:126558318-126558340 GAGGACCTGCCTGGGCATTGAGG + Intergenic
1061151893 9:128833532-128833554 GAGGATCTCTGCGGGCATGTGGG + Exonic
1061271402 9:129545586-129545608 CAGGCTCTGTGTTGGCATTGGGG - Intergenic
1061726689 9:132585973-132585995 AAGGATATGTGTTGGAATAGGGG - Intronic
1061766997 9:132887838-132887860 GAGGATCTCTGTGGGCTTCTGGG - Intronic
1185773968 X:2787376-2787398 GAGGTTCTGTGTGTGAATGGAGG + Intronic
1187132589 X:16517140-16517162 GAGAATCTGTGTGTGCTTGGGGG + Intergenic
1189177799 X:38975421-38975443 GAGAGTCTGTGTGGGAAAAGGGG - Intergenic
1189876801 X:45444565-45444587 GGGGATCTGTCTGGGCACTGAGG + Intergenic
1190335717 X:49260588-49260610 GATGATCTGTCTGGGGGTAGAGG + Intronic
1192684475 X:73289105-73289127 GAGGGAGTGTGTGGCCATAGAGG - Intergenic
1195932977 X:110097257-110097279 AAAGATCTGGCTGGGCATAGTGG - Intronic
1201889012 Y:18921017-18921039 TAGGATCTGTCTGGGCACAGTGG + Intergenic