ID: 962921363

View in Genome Browser
Species Human (GRCh38)
Location 3:139953384-139953406
Sequence ATGTTCCCCCTGAACCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962921358_962921363 15 Left 962921358 3:139953346-139953368 CCCTGTGACACGCAATTTACTCA 0: 1
1: 10
2: 82
3: 318
4: 664
Right 962921363 3:139953384-139953406 ATGTTCCCCCTGAACCTCTAGGG 0: 1
1: 0
2: 3
3: 8
4: 108
962921356_962921363 21 Left 962921356 3:139953340-139953362 CCACACCCCTGTGACACGCAATT 0: 1
1: 9
2: 140
3: 374
4: 724
Right 962921363 3:139953384-139953406 ATGTTCCCCCTGAACCTCTAGGG 0: 1
1: 0
2: 3
3: 8
4: 108
962921359_962921363 14 Left 962921359 3:139953347-139953369 CCTGTGACACGCAATTTACTCAT 0: 4
1: 26
2: 155
3: 459
4: 879
Right 962921363 3:139953384-139953406 ATGTTCCCCCTGAACCTCTAGGG 0: 1
1: 0
2: 3
3: 8
4: 108
962921357_962921363 16 Left 962921357 3:139953345-139953367 CCCCTGTGACACGCAATTTACTC 0: 1
1: 8
2: 81
3: 375
4: 731
Right 962921363 3:139953384-139953406 ATGTTCCCCCTGAACCTCTAGGG 0: 1
1: 0
2: 3
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962921363 Original CRISPR ATGTTCCCCCTGAACCTCTA GGG Intronic
904922698 1:34021275-34021297 ATGCATCCCCTAAACCTCTAGGG + Intronic
905550772 1:38836629-38836651 ATGCTCCCCCTGTCCCTCTTGGG - Intergenic
906976395 1:50577560-50577582 ATCTTTCCCCTGAACTTCTAAGG + Intronic
912263115 1:108128876-108128898 ATGTTCCCCCTTAAGATATAGGG - Intergenic
919467675 1:197942139-197942161 GTGTGCCTCCTGAAACTCTATGG - Intergenic
1066794267 10:39101591-39101613 GTTTTCCCCCTAAACCTCTCTGG - Intergenic
1071019622 10:81036481-81036503 TTATTTCCCCTGAACCTCTCAGG - Intergenic
1071273037 10:84026526-84026548 ATGTTCAACCTGTATCTCTAGGG + Intergenic
1074053880 10:109904542-109904564 ATGTGCACTCTGTACCTCTAAGG - Intronic
1075416660 10:122269334-122269356 ATGCTGCCCCTGAGCGTCTAGGG + Intergenic
1075448625 10:122531303-122531325 GTGTTCCCCTAGAGCCTCTAGGG + Intergenic
1076117954 10:127913728-127913750 AGGTTCCCGGTGAAACTCTAGGG + Intronic
1078560200 11:12364535-12364557 ATGTTCCCTCTGAGACTCTAGGG + Intergenic
1079513676 11:21240876-21240898 ATGTTTCCCTTAAGCCTCTAGGG - Intronic
1080554040 11:33399648-33399670 CTGTTCCCCCTCACCCTCCAGGG + Intergenic
1081418532 11:42844170-42844192 GTGTTCCCTATGAAACTCTAAGG + Intergenic
1082994832 11:59244880-59244902 ATGATCCCCATAAACCTTTATGG - Intergenic
1084408775 11:68994113-68994135 ATGCGCCCCCTGAGGCTCTAGGG - Intergenic
1084611943 11:70208871-70208893 TTGTTCTACCTGAATCTCTAGGG + Intergenic
1089069122 11:115685523-115685545 ATGTACCCCTTGAACCTAAAAGG + Intergenic
1089637794 11:119827412-119827434 ATATTCCCCCAAAACCTCTCAGG - Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1095820370 12:46471777-46471799 ATGTTCCCAATGAATCACTATGG - Intergenic
1097307890 12:58089227-58089249 ATTTTCCCCCTGCACTTCCATGG + Intergenic
1099621914 12:85012870-85012892 AAGTGCTCTCTGAACCTCTAAGG + Intergenic
1102652536 12:114452202-114452224 ATGTTCCCCCAGACCCTTGATGG - Intergenic
1103166924 12:118778300-118778322 ATGTTCCCTCAGAGGCTCTAGGG - Intergenic
1103795880 12:123502862-123502884 ATGCTTCCTCTGGACCTCTAAGG + Intronic
1109224495 13:59675790-59675812 ATGTTCCCCCAGAACCATGAGGG - Intronic
1109621284 13:64909992-64910014 ATTTTCCCTCTGAATCTTTAGGG + Intergenic
1113140575 13:107144353-107144375 ATGCTCCCTCTGAGCCTCTTGGG - Intergenic
1114529605 14:23387687-23387709 ATGTTCCCCCTGCCCCTGCATGG + Intronic
1120252098 14:82070265-82070287 ATGCTCCCTCTGGAGCTCTATGG - Intergenic
1122355820 14:101122298-101122320 AGGTTCCCCCTCAGCCTCTCGGG - Intergenic
1125368348 15:38943050-38943072 ATGGTCCCTGTCAACCTCTAAGG + Intergenic
1126562432 15:50058627-50058649 AATTTTCTCCTGAACCTCTAAGG + Intronic
1128800587 15:70494454-70494476 AGGCTCCCCCTGAGCCTCTGTGG - Intergenic
1130427007 15:83811582-83811604 ATGATGCCCCTGAAGCTCTCTGG + Intronic
1135249360 16:20887926-20887948 ATCTTCCTCCTGAAACCCTATGG - Intronic
1138385204 16:56632011-56632033 ATGTTCCCCCACATCCTCTCAGG + Intergenic
1140555695 16:75918567-75918589 ATGTTCTCCCAGATTCTCTAAGG - Intergenic
1141244525 16:82293553-82293575 ATGATCCCCCTGAACCCTTTAGG - Intergenic
1144931373 17:18861806-18861828 ATGTTTCCCATAAATCTCTAAGG + Intronic
1145970783 17:28955349-28955371 AGGGTCCCCCTGAACCCCTTAGG + Exonic
1146916727 17:36682750-36682772 ATGTTCCCTCTGCAGCTCTTTGG + Intergenic
1157722487 18:49936193-49936215 CTGTTCCACCTGAACCTCTAAGG + Intronic
1159049086 18:63400784-63400806 ATTTTCACTCTAAACCTCTAAGG + Intronic
1166190648 19:41174490-41174512 ATGATCCCCATAAACCTCTGAGG + Intergenic
1166676165 19:44742302-44742324 TTGCTCTCCCTGAACCTCTCTGG + Intergenic
929750144 2:44702837-44702859 ATTTACCCCCTGAATCTCTTAGG + Intronic
930123795 2:47781288-47781310 ATGTTCCCCCAGACTCTCTGGGG + Intronic
930337375 2:50066407-50066429 TTGTTCTCTCTGAACTTCTATGG - Intronic
934515132 2:94981566-94981588 ATCTTCCCTCTGAACTTCCAGGG - Intergenic
939435985 2:142178493-142178515 ATGTTTCCCCTGTATCTCCAAGG - Intergenic
941597089 2:167490981-167491003 ATGTGCCCCTGGATCCTCTAAGG - Intergenic
943900903 2:193434696-193434718 ATGTTCCCTCTGAAACTCACAGG - Intergenic
944380161 2:199099744-199099766 GGGTCTCCCCTGAACCTCTAAGG + Intergenic
947169671 2:227298688-227298710 CTGGTCCCCCTGGACCTCCAGGG + Exonic
947987033 2:234457130-234457152 ATGCTGCCTCTGAATCTCTAAGG - Intergenic
1174930521 20:54808952-54808974 ATGTTCCTCCAGAACTTTTAAGG + Intergenic
1175677282 20:60957684-60957706 GTGTACCCCCTGGACCTCCAGGG - Intergenic
1175735398 20:61382637-61382659 ATGTTCCCCCTGAAGCTTCCGGG + Intronic
1182313751 22:29427961-29427983 ATTATCCCCCAGACCCTCTAGGG - Intergenic
1182552053 22:31105879-31105901 CTGTTCCCCCTGAGCCTCTTGGG - Intronic
951113700 3:18835175-18835197 ATTTTCCCACTGAACATATAGGG - Intergenic
951647506 3:24909229-24909251 TTGTTCTCACTGAACCACTAGGG + Intergenic
953366882 3:42352713-42352735 ATGTGCCCCAGGAGCCTCTATGG - Intergenic
954066107 3:48107561-48107583 ATCTTCCCAATGAGCCTCTAAGG - Intergenic
954920206 3:54184204-54184226 ATGTTCCGACAGAACCTCTAGGG - Intronic
955065216 3:55528019-55528041 ATATTACCCCTGATCCTCCAAGG - Intronic
956318259 3:67964781-67964803 ATGCTCCCTCTGAATATCTAGGG + Intergenic
959414833 3:106071754-106071776 AAGATCCCCCTGAACTACTATGG + Intergenic
962921363 3:139953384-139953406 ATGTTCCCCCTGAACCTCTAGGG + Intronic
963111240 3:141689893-141689915 ATGTTCACCCTGAGACTTTAAGG + Intergenic
965620862 3:170641150-170641172 ATGGTCCCACAGCACCTCTAGGG + Intronic
965653470 3:170958546-170958568 ATGCTCCTTCTGAAGCTCTAAGG - Intergenic
969087173 4:4665171-4665193 ATGTTCCCTCTGAAGCTCTTGGG + Intergenic
974563506 4:63553319-63553341 ATTTTCCTCCTAAACCTCCAGGG + Intergenic
974799040 4:66791681-66791703 ATGTTTCCCCTCCACCTCTTAGG + Intergenic
978867907 4:113537354-113537376 CTGGTCCCCTTGAACTTCTATGG + Exonic
981163332 4:141525513-141525535 ATGTACCCACTGAACCAGTACGG - Intergenic
984473695 4:180211142-180211164 ATGCTCTCTCTGAAACTCTAAGG + Intergenic
987280992 5:16413560-16413582 ATGTTCCCCCTGGACTTCTATGG + Intergenic
992466864 5:77014875-77014897 ATATTCCCACTGAATCTCTGTGG + Intergenic
992571186 5:78059301-78059323 ATGTTCCTTCTGGAGCTCTAGGG - Intronic
996833410 5:127764904-127764926 ATTTTCTCCCTGAAGCTCCAGGG - Intergenic
997140624 5:131376509-131376531 ATGTACCCCCTGAACCTCAAAGG - Intronic
999263776 5:150253457-150253479 CTGCTCCCCCTCCACCTCTATGG + Exonic
1001085650 5:168698515-168698537 ATGCTCCCTCTGAGCCTCTAGGG - Intronic
1002423412 5:179162300-179162322 ATGTTCACCCTGATCCTTCATGG - Intronic
1007898301 6:45385348-45385370 ATGTTCTCACTGAACCGCTTTGG + Intronic
1008558211 6:52695933-52695955 ATGTTAGCCCTGAACATCAATGG + Intergenic
1009658808 6:66582155-66582177 GTGTTCCTACTGAAACTCTAGGG - Intergenic
1012713435 6:102637693-102637715 ATGATCCCCATAAATCTCTATGG - Intergenic
1014855762 6:126398673-126398695 ATGTATCCCCTGAACCTAAAAGG - Intergenic
1023895487 7:44429480-44429502 ATGTTCCCTCTGAAGGTCTTAGG - Intronic
1026824690 7:73574106-73574128 ATGTTCCCGCTGTGGCTCTAGGG + Exonic
1027589942 7:80105878-80105900 ATGTTTCCTCTGAGGCTCTAGGG - Intergenic
1027772692 7:82427104-82427126 AAGTTCCCCCTTATCCACTAGGG - Intronic
1030287023 7:107837368-107837390 ATGTCCCCCCAGCACCTTTAGGG - Intergenic
1034377091 7:150655669-150655691 ATGATCCCCTTGAATCTTTATGG + Intergenic
1035172839 7:157028968-157028990 ATGTTCACCCCCAACCTCCAAGG - Intergenic
1035954905 8:4066244-4066266 CTGTTCCCACTGCACCTCTGAGG + Intronic
1036974340 8:13394153-13394175 ATGTTCCTATTCAACCTCTATGG + Intronic
1037603634 8:20419643-20419665 TTGTTTCCCCTGATTCTCTAGGG + Intergenic
1039385935 8:37135610-37135632 ATTTTCCCTCAGAACCTCTCTGG + Intergenic
1039593677 8:38771273-38771295 ATATTTTCCCTGAAACTCTAGGG - Intronic
1040315026 8:46256437-46256459 ATGTTCCCCCTGAGTCTCTGTGG - Intergenic
1052235983 9:26214035-26214057 CTTTTCCCCCTGATTCTCTAGGG + Intergenic
1058628707 9:106962992-106963014 ATGTTCCCCCTTAGACACTATGG + Intronic
1059162775 9:112050936-112050958 ATGTTCCCACTGCATCTCTAAGG + Intronic
1187369289 X:18691048-18691070 CTGTTCCCCTTGAACCTGTGTGG + Exonic
1194312303 X:92326421-92326443 ATGTTCCCCTTGAATCTCAGTGG - Intronic
1195448569 X:104982124-104982146 ATGTACCCCATGAACCTAAAAGG + Intronic
1195487718 X:105428464-105428486 AGATTCCCCCTAAATCTCTAGGG + Intronic
1195790332 X:108577446-108577468 ATGTTGCCTCTTAACCTCAATGG - Intronic
1197717365 X:129719188-129719210 AGGTTCCCCTAGAACCTCCATGG + Intergenic
1198051213 X:132955416-132955438 ATGTTCCCCTTAAATCTCAATGG + Intronic
1199594742 X:149497698-149497720 CTGTTCCCCCTGAGCCTGTCAGG - Intronic
1200620573 Y:5440536-5440558 ATGTTCCCCTTGAATCTCAGTGG - Intronic