ID: 962921853

View in Genome Browser
Species Human (GRCh38)
Location 3:139957535-139957557
Sequence ATGAGCTATGTGAAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962921850_962921853 -3 Left 962921850 3:139957515-139957537 CCTGATTGGTTTATTAGATAATG 0: 1
1: 0
2: 1
3: 12
4: 201
Right 962921853 3:139957535-139957557 ATGAGCTATGTGAAGGTGCAGGG 0: 1
1: 0
2: 2
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962921853 Original CRISPR ATGAGCTATGTGAAGGTGCA GGG Intronic
902754262 1:18538837-18538859 ATAATGTATGTGAAGGTGCATGG + Intergenic
904966749 1:34380093-34380115 ATGAACTATGTGAAGAGCCAGGG - Intergenic
908307432 1:62837043-62837065 ATGAGCTCTTTCTAGGTGCAAGG + Intronic
910297481 1:85664609-85664631 AGGAACTAGGTGAAGGTGGAGGG + Intronic
913251631 1:116916724-116916746 ATGAGCTGTTTGAAGATGCAAGG + Intronic
916520265 1:165557289-165557311 GTGAGCTAAGTGAAGCTCCAAGG - Intronic
917972526 1:180217959-180217981 ATGAGCTCTGAGCAGGAGCATGG - Intergenic
918127996 1:181601126-181601148 ATGGGCTAGCTGAAGGTGCAGGG + Intronic
921302840 1:213766968-213766990 AGGAGCTATGAAAAGGTGAAAGG - Intergenic
922438813 1:225633691-225633713 ATGATCCATGTGAAGTTGCCTGG + Intronic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
924835831 1:247646234-247646256 GGGAGCAATGTCAAGGTGCATGG + Intergenic
1067833514 10:49623799-49623821 ATGGGTTACATGAAGGTGCAAGG - Intronic
1068948350 10:62752355-62752377 ATTAGCTATGGGAACTTGCATGG - Intergenic
1070357607 10:75655875-75655897 ATGAGGGATGTGCAGGTGAAGGG - Intronic
1071238790 10:83680815-83680837 GTGAGCCTTGTGAAGGTGCTTGG + Intergenic
1072397314 10:95057926-95057948 AAGGGCTATGTCAATGTGCAGGG + Intronic
1073543661 10:104331779-104331801 CTGAGCTATCTGAGGGTGAAAGG - Intronic
1074669507 10:115773660-115773682 ATGTGATCTGTGCAGGTGCAGGG - Intronic
1075270333 10:121043831-121043853 ATGAGTTTTGTAAAGGTGCATGG - Intergenic
1075792958 10:125098584-125098606 ATTGGCACTGTGAAGGTGCAGGG - Intronic
1076071675 10:127495308-127495330 ATGAGCTATGTGGTGATTCAGGG + Intergenic
1077935286 11:6778754-6778776 AAAAGCTATGTGAAGATGTATGG - Intergenic
1077944901 11:6886150-6886172 ATGAGTTATGTAAAGAGGCAAGG + Intergenic
1078454896 11:11467357-11467379 AAGGGCTCTGTGAAGGGGCAGGG - Intronic
1079881846 11:25938234-25938256 ATGAGCCATGTGAAGGTTTCTGG - Intergenic
1079960175 11:26914109-26914131 AAAAGCCATGTGAAGGTGCAGGG + Intergenic
1080056809 11:27915259-27915281 CTCTGCTATGTGAAGGTGCTTGG - Intergenic
1080776991 11:35395206-35395228 ATTAGCTCTGTGTTGGTGCATGG - Intronic
1081341286 11:41930843-41930865 ATGAGCAATGGCAAAGTGCAGGG - Intergenic
1083470724 11:62881916-62881938 CTGAGCTCTCTGAAGGTGAAGGG + Exonic
1084515129 11:69633904-69633926 ATGCCCTCTGTGAAGATGCAGGG + Intergenic
1087497694 11:98910871-98910893 ATGAGCTTTGGGAGGGTCCAGGG + Intergenic
1087969855 11:104466752-104466774 ATGAGCCAAATGAAGATGCATGG - Intergenic
1090658767 11:128865717-128865739 CTGAGCTGTGACAAGGTGCAGGG + Intronic
1092686858 12:11058338-11058360 AAGAGATATGTGAAGATTCAGGG + Intronic
1093674296 12:21917644-21917666 TTGTGCTATGTGAAAGTGCGTGG - Intronic
1094639794 12:32262757-32262779 AGGAGCTTTCTGAAGGTGCATGG + Intronic
1096325760 12:50659822-50659844 ATGAGCGCTGTGCAGGTGCCTGG - Intronic
1098262362 12:68684398-68684420 ATGAGGAATCTGCAGGTGCAGGG + Intergenic
1099663382 12:85595892-85595914 ATGAGATATGTGAGGGGCCAGGG - Intergenic
1100678789 12:96896743-96896765 GTCAGCTATGTGAAGGTGGGAGG + Intergenic
1103430361 12:120879550-120879572 ATGAGCTATGAGAAGTTGGGCGG - Intronic
1106808336 13:33334426-33334448 ATGAGGTAAGTGAAGGAGCTTGG - Intronic
1108039747 13:46329050-46329072 ATGAGCTGTGAGAAAGTTCAAGG + Intergenic
1108505491 13:51108920-51108942 TTGAGCTATCTGAAGATGGAGGG - Intergenic
1109071788 13:57778823-57778845 TTGAGGTATGTGAAAGTGCCTGG + Intergenic
1110641564 13:77830404-77830426 ATGAGCTTTGTGAACATGAATGG - Intergenic
1111239777 13:85458423-85458445 ATGAGATTTGGGAAGGAGCAGGG + Intergenic
1113239687 13:108323024-108323046 ATGTGCTATGTGTAGGTGTCAGG - Intergenic
1113294899 13:108948137-108948159 AGGAGCAAAGTGAGGGTGCATGG + Intronic
1113315236 13:109172826-109172848 ATGAGGTAGATGGAGGTGCAAGG + Intronic
1113468967 13:110531039-110531061 ATTAGCTATGGGAAGAAGCATGG + Intronic
1113516665 13:110908079-110908101 AAGAGCCAGGTGAAGGTGCCCGG + Intronic
1114230566 14:20778031-20778053 ACGAGTTATGGGAAGGTGAAGGG - Intergenic
1117437511 14:55730899-55730921 AAGAGATATGTGAAGGAACAGGG + Intergenic
1120733444 14:88027833-88027855 ATGTGTTATATGGAGGTGCAGGG - Intergenic
1121708934 14:96022448-96022470 CTGAGCTTTGAGAAGGGGCATGG - Intergenic
1125767429 15:42144987-42145009 ATGAGGGCTGTGAAGGTGAACGG + Intronic
1126867762 15:52954919-52954941 ATGGGCTATGTGAAATTCCAAGG - Intergenic
1126927987 15:53612475-53612497 TTGAGCTATATGAAGGTCTAGGG + Intronic
1127329389 15:57923718-57923740 ATGAACGATGTGAAGGTGGTGGG - Intergenic
1129539208 15:76337621-76337643 ATGAGCTCTCTAAAGGTCCAGGG - Intronic
1129904141 15:79174069-79174091 ACAAGCTTTGTGAAGATGCAAGG + Intergenic
1131789551 15:95949227-95949249 AGGAGGAAAGTGAAGGTGCATGG + Intergenic
1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG + Intronic
1133397741 16:5461859-5461881 ATGAGCTCAGTGAAGCTGGATGG - Intergenic
1136463013 16:30423657-30423679 ATGAGTTATGTGAATGCTCAGGG - Exonic
1137834810 16:51581751-51581773 ATCAGCTATGTTAAGGTGTTAGG - Intergenic
1138178080 16:54921199-54921221 ATGAGCTTTTTCAAGGGGCATGG - Intergenic
1139530557 16:67540497-67540519 ATGAGGTATGAGAATGTGCAGGG + Exonic
1140615932 16:76664065-76664087 AGCAGCTACGTGGAGGTGCACGG - Intergenic
1141039912 16:80664309-80664331 ATTAGATGTGTGAAGGTGGACGG - Intronic
1144630291 17:16868382-16868404 ATGAGCTAAGGGAAGGGGAATGG + Intergenic
1145008731 17:19354019-19354041 CTGAGCTATTTGAATTTGCAGGG - Intronic
1150898384 17:69240157-69240179 AAGAGCTAGGAGAATGTGCATGG - Intronic
1154381470 18:13854599-13854621 GTAAGCTGGGTGAAGGTGCATGG + Intergenic
1155809479 18:30213872-30213894 ATGAGCTATGTGAATTTCTAAGG - Intergenic
1163173221 19:15547420-15547442 ATGAATTATGTGGAGGTCCAGGG - Intronic
1166056529 19:40292987-40293009 ATAAGTTATGGGAGGGTGCAGGG - Intergenic
1166934083 19:46320620-46320642 GTGAGCCATGTTAAGGTGCTTGG - Intronic
924962022 2:44431-44453 ATAAACTAAGTGAAGATGCATGG - Intronic
925296348 2:2780024-2780046 GTGAACTCTGGGAAGGTGCAGGG - Intergenic
925296382 2:2780169-2780191 ATGAACTCTGGGAAGGTGCAGGG - Intergenic
925296530 2:2780904-2780926 GTGAACTCTGGGAAGGTGCAGGG - Intergenic
927690197 2:25202838-25202860 ATAATCTATGTGAAAGTGCCTGG - Intergenic
928160150 2:28915635-28915657 ATGAGCTGTGTAAATTTGCATGG + Intronic
928784232 2:34862765-34862787 ATGAGGTATGTGAATGTCTATGG - Intergenic
929714011 2:44292663-44292685 ATGAGCTAAGTGAAGAGGCATGG + Intronic
930666677 2:54105823-54105845 ATGTGCCATGTGTAGGTGCTGGG - Intronic
931587613 2:63845314-63845336 ATGAACTATGTGGATGTGCTAGG + Intronic
932054199 2:68428291-68428313 AAGAGCTATGTGCAAGTGCAGGG - Intergenic
933977265 2:87521583-87521605 ATGAGCTGTGTGGACGTGCCAGG - Intergenic
935513046 2:104000151-104000173 ATCAGCTTTGTGATTGTGCACGG + Intergenic
935813958 2:106829124-106829146 ATAAGCTATGTGAACAGGCATGG + Intronic
935949078 2:108312556-108312578 ATGAGATATGGGAGGGGGCAGGG + Intergenic
936316554 2:111429222-111429244 ATGAGCTGTGTGGACGTGCCAGG + Intergenic
936711789 2:115140256-115140278 ATGAGCTATGTGGATGTTCTAGG + Intronic
937320867 2:120959965-120959987 GTGAGCTCTGTGCAGGCGCAGGG + Intronic
937589398 2:123594959-123594981 ATAAGCTATGTCATGGTACATGG + Intergenic
939690483 2:145254243-145254265 TTGATCTATGGGGAGGTGCACGG - Intergenic
940112149 2:150166795-150166817 ATGTGATATATGAAGATGCAAGG + Intergenic
941123851 2:161562353-161562375 ATGAGATTTGGGAAGGGGCAGGG + Intronic
942648798 2:178145291-178145313 ATGACCTAATTGAAGGTGCTTGG - Intergenic
943423430 2:187698477-187698499 ATGAGATTTGTGAAGGGCCATGG + Intergenic
1179201243 21:39223614-39223636 ATGAGCTAAGTGTAGGTACCAGG + Intronic
1179506226 21:41843609-41843631 GTGAGCAATGTGAGGCTGCAGGG + Intronic
1179595496 21:42440273-42440295 ATCAGAAATGTGAAGGGGCAGGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1181376956 22:22466387-22466409 ATGGGCTATGGGAGTGTGCAGGG + Intergenic
1182701691 22:32245362-32245384 GTGAGCTAGGTGTGGGTGCAGGG - Intronic
951738990 3:25899104-25899126 ATGAGGTAGGTGATGGTGCTGGG + Intergenic
951827955 3:26889420-26889442 ATGAGCTATGGAAAGGGGAACGG + Intergenic
951843720 3:27062890-27062912 ATGAGAAAGATGAAGGTGCAAGG + Intergenic
953105069 3:39869901-39869923 ATGAGATATGTCAAGGTGGAGGG + Intronic
953641654 3:44713244-44713266 CTGAGCTTTGTGAAGAAGCAAGG - Intronic
954719743 3:52551278-52551300 ATGAGCTTTGTGAAGGCTGAAGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
957377612 3:79378911-79378933 ATGAGGAATGTGAAGCTCCAGGG - Intronic
957479976 3:80780231-80780253 AGGAGCTACTTGAAGGTGAATGG + Intergenic
959263320 3:104107435-104107457 CTGTGCTATGTGTTGGTGCAAGG - Intergenic
962921853 3:139957535-139957557 ATGAGCTATGTGAAGGTGCAGGG + Intronic
964544856 3:157822636-157822658 ATGAGTCATGTGAAGGCCCAGGG - Intergenic
964987349 3:162760459-162760481 AGGACCTATTTGAAGGTGGAGGG - Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966283045 3:178257664-178257686 CTCAGCCATGTGAAGATGCAGGG + Intergenic
967209748 3:187157888-187157910 ATGAGCTATGGGAAGGGTCAGGG + Intronic
967242137 3:187450142-187450164 ATGATCGAAGTGAAGGTGCTTGG - Intergenic
967611257 3:191508805-191508827 ATGAGGCATGTGAAGGAGCGTGG + Intergenic
968886607 4:3337936-3337958 ATGAGCTGTGTGACCTTGCACGG + Intronic
970548329 4:17153144-17153166 AGGAGATACGTGAAGGTGAAAGG - Intergenic
971681387 4:29705975-29705997 ATGAGGTTTGTGAGGGTTCAGGG - Intergenic
971766622 4:30840459-30840481 ATGAGATAGATGAAGCTGCAAGG - Intronic
974940817 4:68465604-68465626 ATGAGATATGTGAATGTACTAGG + Intronic
977067443 4:92335884-92335906 AAGAGCTATGTGGTGGTCCATGG + Intronic
979967003 4:127087354-127087376 ATGAGATTTGGGAGGGTGCAGGG + Intergenic
989632871 5:43504743-43504765 GTAAGCTATGTGAAGGATCATGG + Intronic
990539078 5:56754221-56754243 ATGAGGTATGAGAATGTACATGG - Intergenic
991174040 5:63665160-63665182 ATGAACTGTGTATAGGTGCAGGG - Intergenic
992549288 5:77845957-77845979 AAGAGCAAGGTGGAGGTGCAGGG + Intronic
994956604 5:106541094-106541116 ATGAGCCATGGGAAGCTGCAGGG - Intergenic
996187289 5:120492704-120492726 ATGGGCGATGTCAAGGGGCAGGG - Intronic
996293928 5:121889572-121889594 ATTAGCTATTTGAAGTTGAACGG + Intergenic
997926356 5:138033714-138033736 ATGAGCTCTCTGAACTTGCATGG + Intronic
1001684808 5:173585435-173585457 ATGAGATTTGGGAAGGTCCAGGG - Intergenic
1003776271 6:9368976-9368998 ATGATCTAAGTGAAGGTTCATGG - Intergenic
1003817847 6:9862182-9862204 ATGAGATTTGGGAAGGGGCAGGG - Intronic
1005172612 6:23005336-23005358 ACAAATTATGTGAAGGTGCAGGG - Intergenic
1006044914 6:31287099-31287121 ATGTGCTGTGTGAAGCTGCCTGG - Intronic
1007386349 6:41522841-41522863 ATGAGCCAGGTGAAGTTCCAGGG + Intergenic
1007954279 6:45902195-45902217 TTGAGCTATGAGAAAGTGGATGG - Exonic
1009652951 6:66499664-66499686 ATGAGTTTTGGGAAGGTCCATGG + Intergenic
1012262323 6:97102004-97102026 ATCAGACATGTGAAGGTGCCTGG - Intronic
1015029391 6:128575917-128575939 TTGAGCTATTTGTAGATGCAAGG - Intergenic
1018229187 6:161659596-161659618 AGGGGCTATGGGAAGGTGCTTGG + Intronic
1018598344 6:165508933-165508955 CTGAGCTCTCTGTAGGTGCAGGG - Intronic
1020083943 7:5300557-5300579 ATGAGCAGTGAGAAGATGCAGGG - Exonic
1020583168 7:10031382-10031404 ATGAGGGATGGGAGGGTGCATGG + Intergenic
1021273222 7:18617737-18617759 ATGAGCTCTCTGAAGATGCTGGG - Intronic
1022127641 7:27373577-27373599 ATGAGCAAGGTGAAGCGGCAAGG - Intergenic
1028570108 7:92277643-92277665 ATGTTCTGTGTGAAAGTGCAGGG + Intronic
1030350917 7:108485393-108485415 AAGAGTTATGTGTAGGTGAATGG - Intronic
1032225652 7:130029444-130029466 ATGAGCTATTTGATGGTGTCAGG + Intronic
1036168463 8:6459831-6459853 CTGAGTAATGTGAAGGTGCCAGG + Intronic
1038120574 8:24609745-24609767 ATGCACTATGTGAAGATACAGGG + Intergenic
1040893053 8:52337600-52337622 ATGAGCAGTGTGAAGGTGTGGGG + Intronic
1040954642 8:52967396-52967418 GGGACCTATGTGAAGGTGGAGGG - Intergenic
1043975546 8:86580937-86580959 ATGAGATATAAGAAGCTGCATGG + Intronic
1044910334 8:97051614-97051636 ATGAGCTCTGTGAACTTGAATGG - Intronic
1046529817 8:115429192-115429214 GTGAGCTATTTGACGGGGCAGGG - Intronic
1047038881 8:120970612-120970634 ATGAGAGCTGTGAAGCTGCACGG + Intergenic
1047061430 8:121231214-121231236 ATGAACAATGTGAAGGTAGAGGG + Intergenic
1047230715 8:122995827-122995849 ATCAGCCATCTGAAGGAGCAGGG - Intergenic
1047363726 8:124193254-124193276 ATGACCTATGGAAAGGTCCATGG + Intergenic
1048236338 8:132694391-132694413 ATAAGGGATGTGAAGATGCAGGG + Intronic
1050214149 9:3303778-3303800 AAGAGCTTTGGAAAGGTGCAAGG + Intronic
1050716822 9:8538122-8538144 ATGAGATTTGTGAAAGTGGATGG - Intronic
1050977294 9:11956332-11956354 ATGAACAATGGGAAGGGGCATGG + Intergenic
1057731685 9:97614639-97614661 ATGCGCCATGTGAAGGTGCAGGG + Intronic
1057731939 9:97617204-97617226 ATGCGCCATGTGAAGGTGCAGGG + Intronic
1058875575 9:109241911-109241933 ATGAGCCATGTGAATGGGGATGG + Intronic
1059842145 9:118229653-118229675 AGGAGGTATGTGGAGGGGCAAGG + Intergenic
1061011802 9:127960336-127960358 ATGAGATGGGTGAAGGAGCAGGG + Intronic
1186642787 X:11473629-11473651 ATGATCCCTGTGAAGGTGCTAGG - Intronic
1186820388 X:13282255-13282277 ATGATATATGTGAAGATGCAAGG - Intergenic
1186881962 X:13875334-13875356 ATGAATTATGGGAAGCTGCAGGG + Intronic
1189153155 X:38728062-38728084 ATGTGATATGTGTAGGTACATGG + Intergenic
1190217813 X:48491860-48491882 ATAACCTGTGTGAACGTGCATGG + Intergenic
1193267735 X:79493659-79493681 ATGAGCTCCCTGTAGGTGCATGG - Intergenic
1193826729 X:86235427-86235449 ATGACCTAGGTGAAGATGGAAGG - Intronic
1194381149 X:93192877-93192899 GTGAGCTCTGTGAAGGTCCTTGG - Intergenic
1197688968 X:129476740-129476762 ATGAGTTTTCTGAAGGTGCAAGG + Intronic
1200463305 Y:3484274-3484296 ATGAGTTATTTGAAGGAACATGG + Intergenic