ID: 962922198

View in Genome Browser
Species Human (GRCh38)
Location 3:139960327-139960349
Sequence CTCTGAAAGGGAAATGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 831
Summary {0: 1, 1: 1, 2: 1, 3: 52, 4: 776}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962922198_962922206 25 Left 962922198 3:139960327-139960349 CCCCCCACATTTCCCTTTCAGAG 0: 1
1: 1
2: 1
3: 52
4: 776
Right 962922206 3:139960375-139960397 CTCTGTCTTGACCTCCTTTGAGG 0: 1
1: 0
2: 2
3: 20
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962922198 Original CRISPR CTCTGAAAGGGAAATGTGGG GGG (reversed) Intronic
900424877 1:2572372-2572394 CTCTGGAAGGCCAAGGTGGGCGG - Intergenic
900824960 1:4918987-4919009 CTCTGCTAGGGCAGTGTGGGAGG - Intergenic
901042508 1:6374017-6374039 CTCTAAAAGGCAGAGGTGGGAGG - Intronic
901244171 1:7715590-7715612 CTGTGAAAGGGGGATGTGGCTGG - Intronic
901778487 1:11576803-11576825 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
901955874 1:12785148-12785170 CTCAGTAAGGGAAAAGTGGCAGG + Intergenic
901979247 1:13021196-13021218 CTCAGTAAGGGAAAAGTGGCAGG + Intronic
902002835 1:13207742-13207764 CTCAGTAAGGGAAAAGTGGCAGG - Intergenic
902022063 1:13353506-13353528 CTCAGTAAGGGAAAAGTGGCAGG - Intergenic
902355089 1:15892265-15892287 CTCTGAGAGGCAGAGGTGGGCGG - Intronic
902945658 1:19835823-19835845 CTTTGAGAGGGCAAAGTGGGAGG + Intergenic
903456675 1:23492218-23492240 CTCTGAAAGGCCAAGATGGGTGG - Intergenic
903485596 1:23687718-23687740 CTTTGGAAGGCAAAGGTGGGAGG + Intergenic
903988788 1:27250038-27250060 CTCTGGTAGGGAAATTGGGGCGG + Intronic
904064867 1:27741635-27741657 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
904681103 1:32229792-32229814 CTCTGGAAGGCCAAGGTGGGCGG - Intronic
905073238 1:35246463-35246485 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
905153411 1:35951630-35951652 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
905412562 1:37780923-37780945 CTTTGGAAGGCAAAGGTGGGAGG + Intergenic
906062837 1:42959439-42959461 CTCACAAACGGGAATGTGGGGGG - Intergenic
906709351 1:47917475-47917497 CTCTGAGAGGCCAAGGTGGGAGG + Intronic
906938474 1:50235195-50235217 CTCTGCTAGGGTAATGTGGAAGG + Intergenic
907147296 1:52246949-52246971 CTTTGGAAGGCAAAGGTGGGTGG - Intronic
908024686 1:59938354-59938376 CTCAGCAAGAGAAATGTGGTAGG + Intergenic
908982597 1:69976816-69976838 CTCTCCAAGGGGAATGTGAGGGG - Intronic
909070176 1:70984469-70984491 CTCTGCAAGGCCAAGGTGGGAGG + Intronic
909083724 1:71147038-71147060 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
909306745 1:74090642-74090664 CTTTGAAAGGCCAATGTAGGAGG + Intronic
909579661 1:77219846-77219868 CTATAAATGGAAAATGTGGGTGG + Intergenic
909629527 1:77757109-77757131 CTTTGAAAGGTAAATATTGGAGG - Intronic
909710831 1:78647402-78647424 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
909755545 1:79220993-79221015 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
909773307 1:79453525-79453547 TTCTGAAAAGGAAGTGGGGGAGG - Intergenic
909939696 1:81596774-81596796 CTCTCAAAAGCAAATGTGTGGGG - Intronic
910044953 1:82902349-82902371 CTCTGAGAGGCCAAGGTGGGCGG + Intergenic
910311012 1:85824661-85824683 CTTGAAAAGGGAAATGTGGTAGG - Intronic
910507360 1:87964992-87965014 CTCAGAAAAGGCGATGTGGGAGG - Intergenic
910939823 1:92521203-92521225 CTTTGAGAGGCAAAGGTGGGTGG - Intronic
911457800 1:98148912-98148934 CTCAGAAGGGGAAAGGTGGGAGG + Intergenic
911627492 1:100141573-100141595 CTTTGGAAGGGTAAGGTGGGAGG - Intronic
911934233 1:103947057-103947079 CTCTGAAAGAGAATTATGGATGG - Intergenic
911972163 1:104452495-104452517 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
912369804 1:109165045-109165067 CTTTGAGAGGCTAATGTGGGAGG + Intronic
912642604 1:111361615-111361637 CTCAGCAAGGGGAATGTGGCAGG + Intergenic
912971566 1:114288686-114288708 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
913658220 1:120982089-120982111 CTCTGATGGGGAAATGAGGTAGG - Intergenic
914009578 1:143765178-143765200 CTCTGATGGGGAAATGAGGTAGG - Intergenic
914522796 1:148433374-148433396 CTCTGATGGGGAAATGAGGTAGG - Intergenic
914648202 1:149673853-149673875 CTCTGATGGGGAAATGAGGTAGG - Intergenic
914844428 1:151274032-151274054 TGCTGAATGGGACATGTGGGAGG + Intergenic
915968222 1:160330928-160330950 CTCTGGGAGGCAAAGGTGGGTGG + Intronic
916609337 1:166375173-166375195 GTCAGAAAGGAAAAAGTGGGAGG - Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917388632 1:174506863-174506885 CTTTGAAAGGCCAATGTGGTTGG + Intronic
917918359 1:179727402-179727424 CTCTGAAAGAAACATGCGGGTGG + Intergenic
917953522 1:180066901-180066923 CTTTGAATGGTAAATGTTGGGGG + Intronic
919326074 1:196108934-196108956 CTCAGAAAGGGGGATGTGGCAGG + Intergenic
919639715 1:200036286-200036308 CTCCGAAAGGAAGCTGTGGGAGG - Intronic
919791426 1:201293201-201293223 CAGTGAAAGGGAGATGAGGGGGG + Intronic
919985906 1:202674813-202674835 GTCTGGAGGGGACATGTGGGAGG - Intronic
920499120 1:206475191-206475213 CTGTGAAAACAAAATGTGGGAGG + Intronic
920681567 1:208077134-208077156 CTCTGAACAGGACATGGGGGAGG - Intronic
921052780 1:211523104-211523126 CTCTGGGAGGGAGAGGTGGGCGG + Intergenic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921213803 1:212920860-212920882 CTATGAAATGTAAATGTAGGTGG + Intergenic
921448845 1:215278959-215278981 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
921547051 1:216485508-216485530 GGCTGGAAGGGAAATGTGGAAGG + Intergenic
921610417 1:217206703-217206725 CTCTGCTAGGGAAGTGCGGGAGG + Intergenic
922332006 1:224585726-224585748 CTTTGAAAGGCCAAAGTGGGAGG - Intronic
922454780 1:225765911-225765933 CTTTGAGAGGCTAATGTGGGAGG - Intergenic
922538535 1:226401642-226401664 CTCTGAGAGGGGAATGAGGTAGG - Intronic
922908568 1:229196314-229196336 CTCTGAGAGGCAGAGGTGGGAGG + Intergenic
923023348 1:230184430-230184452 CTCTGAGAGGCCAAGGTGGGTGG - Intronic
923127649 1:231046530-231046552 CTCTGAAAGGCCAAGGCGGGAGG + Intergenic
923565345 1:235072276-235072298 CCCTGAGAGGGGAATGAGGGTGG - Intergenic
924121585 1:240805129-240805151 CTCTGAGAGGCTAAGGTGGGAGG + Intronic
1063228138 10:4035177-4035199 ATTTAAAAGGGAAAAGTGGGAGG - Intergenic
1063310236 10:4945401-4945423 CTCTGCTAGGGCAATGTGGAAGG + Intronic
1063488114 10:6438839-6438861 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
1063524181 10:6768848-6768870 CACTGAAAGAGAAATTTAGGTGG - Intergenic
1063632537 10:7747641-7747663 CTTTGAGAGGCCAATGTGGGAGG + Intronic
1063965968 10:11346066-11346088 CTTTGAGAGGGAAATGAGGGAGG - Intergenic
1064098383 10:12441438-12441460 CTTTGAAAGGCCAAAGTGGGTGG - Intronic
1064598129 10:16966690-16966712 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1064642657 10:17430047-17430069 CTCAGAAAGGGGAAGATGGGAGG - Intronic
1064734769 10:18370541-18370563 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1064993593 10:21277451-21277473 CTTTGAGAGGCAAAAGTGGGTGG - Intergenic
1065331471 10:24604782-24604804 CCCTGAACTGGAAATGTGGCAGG + Intronic
1066118323 10:32259735-32259757 CTTTGAGAGGGCAAGGTGGGAGG - Intergenic
1066316513 10:34252553-34252575 ATCTGAAAGGGAAATGGCAGCGG + Intronic
1067378207 10:45747826-45747848 CTCTGGGAGGGCAAAGTGGGTGG - Intronic
1067436219 10:46280756-46280778 CTCTGGGAGGCAGATGTGGGAGG - Intergenic
1067729691 10:48801313-48801335 TTCTGGAAAGGAAATGTGAGAGG + Intronic
1067840246 10:49670076-49670098 CTCAGAAGGGGGAGTGTGGGGGG - Intergenic
1067899832 10:50228078-50228100 CTCTGAAAGGTCAAGGTGGGAGG + Intronic
1068449707 10:57170335-57170357 CTCTGAGAGGCCAAAGTGGGTGG + Intergenic
1068510784 10:57963391-57963413 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1069289594 10:66761289-66761311 ATCAGAAAGGAAAAAGTGGGTGG - Intronic
1070030567 10:72673018-72673040 CTTTGGAAGGCCAATGTGGGAGG - Intergenic
1070068208 10:73059019-73059041 CTCTGAGAGGCCAAGGTGGGTGG - Intronic
1070695622 10:78561194-78561216 CTCTGTGAGGAAAAGGTGGGGGG + Intergenic
1072143561 10:92612763-92612785 CTCTGAAAGCTGGATGTGGGTGG - Intronic
1072969824 10:100007665-100007687 CTATGAAAGGCAGCTGTGGGAGG - Intronic
1073087142 10:100899802-100899824 CTCTGGAAGGCCAAGGTGGGTGG - Intergenic
1073557693 10:104468455-104468477 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1073574846 10:104613773-104613795 CTCTGAAAGGGGAATGTTAGAGG + Intergenic
1074286239 10:112100661-112100683 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1075276703 10:121100178-121100200 CTCAGGAAAGGAAGTGTGGGTGG + Intergenic
1075685563 10:124363026-124363048 CTCTGAGAGGCCAAGGTGGGAGG - Intergenic
1075888499 10:125924005-125924027 CTTTGAGAGGCAAAGGTGGGAGG + Intronic
1076346515 10:129782449-129782471 CTCTGGGAGGCAAAGGTGGGCGG + Intergenic
1077118780 11:897354-897376 CTCTGAAACGGAAATGAGTGTGG + Intronic
1077616481 11:3678259-3678281 GTCTGAAAGAAAAAGGTGGGTGG - Intronic
1077767024 11:5170148-5170170 CTCTGAAATAAAATTGTGGGAGG - Intronic
1078038246 11:7831747-7831769 CTATGAAAGAGTAATGTGAGGGG - Intergenic
1078102446 11:8337776-8337798 CCCTGAAATGGAAATGTATGTGG - Intergenic
1078162587 11:8854630-8854652 CTTTGAGAGGGCAAGGTGGGAGG + Intronic
1078411463 11:11123617-11123639 CTCAGAAGGGGAAGAGTGGGAGG - Intergenic
1078602155 11:12742925-12742947 TTCTGTAATGGAGATGTGGGAGG + Intronic
1078959508 11:16248385-16248407 CTCTGATAGGGCAGTGTGGAAGG - Intronic
1079136359 11:17777997-17778019 CTCTGAAAGAGTAGAGTGGGGGG - Intronic
1079697784 11:23504873-23504895 CCCTGAAAAGGAAATTTGGGTGG - Intergenic
1079795637 11:24799352-24799374 CTTTGAGAGGCCAATGTGGGGGG + Intronic
1080013052 11:27477400-27477422 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1080016802 11:27516250-27516272 CTCTGGAAGGTCAAGGTGGGTGG - Intergenic
1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG + Intergenic
1081280983 11:41209035-41209057 ATTTGAAGGGGAAAGGTGGGAGG + Intronic
1081792109 11:45795504-45795526 CTCTGCAAGTGAATTTTGGGAGG - Intergenic
1081912311 11:46707644-46707666 CTCTGGAAGGCCAAAGTGGGAGG + Intergenic
1082054772 11:47804891-47804913 CTTTGGAAGGGTAAGGTGGGAGG + Intronic
1082268314 11:50143072-50143094 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1082287759 11:50335443-50335465 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1082734257 11:56838798-56838820 CTCTGTTAGGGCAATGTGGAAGG - Intergenic
1082969598 11:59005503-59005525 CTCAGCAAGGGGAATGTGGCAGG - Intronic
1083047483 11:59749829-59749851 CTTTTAAAGGGAGATATGGGCGG + Intronic
1083085068 11:60134372-60134394 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1083650650 11:64202489-64202511 CTCTGGAAGGCCAAGGTGGGTGG - Intronic
1084200209 11:67552004-67552026 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1085243301 11:75076235-75076257 ACCTGAAAGGGAATTGGGGGGGG - Intergenic
1085372094 11:76018648-76018670 CTCTGGAAGGCCAAGGTGGGTGG - Intronic
1085385621 11:76156534-76156556 CTCTGAGAGGCCAAGGTGGGTGG - Intergenic
1085998339 11:81949755-81949777 CTCGGAAGGGGAAGGGTGGGAGG - Intergenic
1086011846 11:82114279-82114301 CTCTTAAAGGGAGATGAGGTAGG - Intergenic
1087070022 11:94069362-94069384 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
1087807271 11:102568764-102568786 CTTTGTCAGGGCAATGTGGGAGG - Intergenic
1088032264 11:105265597-105265619 CTCAGAGAGGGGAATGTGGCAGG - Intergenic
1088622416 11:111699355-111699377 CTCTGAAAGGCAACAGTTGGTGG + Intronic
1088924143 11:114283483-114283505 CTATGAAAGGGAAATGAGAGTGG + Intronic
1088930280 11:114344340-114344362 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1090663033 11:128895282-128895304 CTCAGAAAGGAAAATGGGAGTGG + Intronic
1090901813 11:131038545-131038567 CTCTGAAAGGCCAAGATGGGAGG - Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091874150 12:3919802-3919824 ATCTGAAGGAGAAATGGGGGTGG + Intergenic
1091981220 12:4865713-4865735 CTCTGGAAGGCCAAAGTGGGTGG + Intergenic
1092317677 12:7436526-7436548 CTTTGAAAGGCAGAGGTGGGAGG + Intronic
1092455141 12:8636410-8636432 CTCGGAGAGGGGAATGTGGCAGG - Intergenic
1092478495 12:8839195-8839217 CACTGAAGGGGAAATTTGGATGG - Exonic
1093046001 12:14445431-14445453 CTCTGGAAGGCCAAGGTGGGCGG - Intronic
1093123376 12:15299850-15299872 CTCTGATAGGGAAGTGTGGAAGG - Intronic
1093395459 12:18675858-18675880 CTCAAAAAGGGAAGGGTGGGAGG + Intergenic
1093537307 12:20237568-20237590 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1093832790 12:23784831-23784853 CTTTGAGAGGGTAAGGTGGGAGG + Intronic
1094137361 12:27142356-27142378 CTCTGAAAGGGAAAAGGGAAAGG + Intergenic
1094186817 12:27652409-27652431 CTCTGAAAGGGAAAAGAGAAAGG + Intronic
1094188766 12:27675083-27675105 CTTTGAAAGGCAGAGGTGGGAGG - Intronic
1094287181 12:28808917-28808939 CTCTCAGAGGGAAATGAGGCAGG - Intergenic
1094451424 12:30586493-30586515 TTCTGAACAGGAAATCTGGGTGG + Intergenic
1094639815 12:32262898-32262920 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1094649860 12:32364990-32365012 CTCTGAGAGGCCAAGGTGGGTGG + Intronic
1095447197 12:42294143-42294165 CTCTGAAAGGCCGAGGTGGGAGG + Intronic
1096189214 12:49604261-49604283 CTCTGGGAGGGGAGTGTGGGTGG - Intronic
1096566107 12:52480563-52480585 CTCTGCTAGGGCAGTGTGGGAGG + Intergenic
1096791030 12:54045080-54045102 CTCTGAGAAAGAAATGAGGGTGG - Intronic
1097609935 12:61807452-61807474 CTCTGCTAGGGCAGTGTGGGAGG + Intronic
1098253215 12:68590208-68590230 CTCTGCTAGGGAAGTGTGGAGGG + Intergenic
1099207293 12:79743353-79743375 CTCTGAGAGTGAAATATGGATGG + Intergenic
1099396528 12:82147220-82147242 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1100956462 12:99914674-99914696 CTCTGATAGGGAAAGGGGGAGGG + Intronic
1101119156 12:101561416-101561438 CTCTGGAAGGCAGAGGTGGGAGG - Intergenic
1101815485 12:108143055-108143077 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1102169140 12:110828891-110828913 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1102340308 12:112116433-112116455 CTTTGGAAGGCAAAGGTGGGAGG - Intergenic
1102480698 12:113221403-113221425 CTGTGAAGGGGAAATGGGGCGGG + Intronic
1102644205 12:114393338-114393360 CTCTGGAAGGGCAAAGTGGGAGG - Intronic
1102827854 12:115965399-115965421 CCCTGAAAGGGAAGTGTGTAGGG + Intronic
1102967744 12:117141212-117141234 CTCTTAATGGGAATTGGGGGTGG + Intergenic
1103472314 12:121191747-121191769 CTCTGGAAGTCACATGTGGGTGG - Intergenic
1103522848 12:121547935-121547957 CTCTGAAAGGGGAAAGAGGCCGG - Intronic
1103592723 12:122003945-122003967 TTCTGAAATAGAAAAGTGGGCGG + Intergenic
1103950231 12:124546654-124546676 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1103984712 12:124759600-124759622 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1104197142 12:126551524-126551546 CTTTGAGAGGCAAATGTGGGTGG + Intergenic
1105220047 13:18317366-18317388 CTTTGAGAGGCAAAGGTGGGAGG - Intergenic
1105308010 13:19182368-19182390 ATCTGAAAGGAAAAAGTGAGTGG + Intronic
1105688677 13:22813848-22813870 CTCGGAAAGGGGAATGTGGCAGG + Intergenic
1105935990 13:25099945-25099967 CTTTGGAAGGCAAAGGTGGGTGG - Intergenic
1106225290 13:27781459-27781481 CTCTGGGAGGCAAAGGTGGGAGG + Intergenic
1106496902 13:30286594-30286616 CTCTGCTAGGGAAGTGTGGAAGG + Intronic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1108010702 13:46005848-46005870 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1108184307 13:47873237-47873259 CTCTGCTAGGGCAGTGTGGGAGG - Intergenic
1108460952 13:50666857-50666879 CCCTGAAGGGCGAATGTGGGTGG - Intronic
1108765712 13:53626617-53626639 CTATGAAAGGTAAAAATGGGAGG + Intergenic
1108927868 13:55775835-55775857 CTCTGAAAAGAAAAGGTGAGGGG - Intergenic
1108928283 13:55780815-55780837 GTCTGAAACGGATGTGTGGGTGG + Intergenic
1109282892 13:60377561-60377583 CTCTGGGAGGGCAAGGTGGGCGG + Intergenic
1109374760 13:61477535-61477557 CTCTGGAAGGGAAAAAAGGGAGG + Intergenic
1109390189 13:61682715-61682737 CTCTGCAAGGGCAGTGTGGTAGG + Intergenic
1109836395 13:67863028-67863050 CTCTGAAAGGGTAAGGAGAGTGG + Intergenic
1110222570 13:73089288-73089310 CTTTGGAAGGGCAAGGTGGGAGG - Intergenic
1110282722 13:73714197-73714219 CTCTGAAAGGCCAAGGTGGAAGG + Intronic
1110830944 13:80030192-80030214 TTCTGAAAGGGACTTGTGGATGG - Intergenic
1111268426 13:85850135-85850157 GTGTGGAAGGGAAATGTGGGTGG - Intergenic
1111426810 13:88095369-88095391 GTGTGGAAGGGAAATGCGGGGGG - Intergenic
1111702690 13:91710912-91710934 CTCCTAGAGGGAAATGTGGGTGG + Intronic
1111703958 13:91724746-91724768 CTCTGTAAGGCCAAGGTGGGAGG + Intronic
1111930177 13:94504610-94504632 CTTTGAAAGGCCAAAGTGGGTGG - Intergenic
1112279646 13:98051344-98051366 CTTTGGAAGGCGAATGTGGGTGG + Intergenic
1112534760 13:100241706-100241728 CTCTGGGAGGCCAATGTGGGTGG - Intronic
1113252773 13:108472488-108472510 CTCTGCTAGGGAAGTGTGGAAGG + Intergenic
1113261574 13:108570491-108570513 CTTTGAGAGGCAAAGGTGGGAGG - Intergenic
1113551303 13:111195142-111195164 CTCTGATAAGGAAAAGTGGTGGG + Intronic
1113716720 13:112514406-112514428 CTCTGGAAGGCCAAGGTGGGAGG + Intronic
1115986440 14:39107176-39107198 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1116019013 14:39439492-39439514 CTATGAAAGGCTAAGGTGGGAGG - Intergenic
1116960321 14:50962191-50962213 CTCTGGAAGGAATATGTAGGTGG - Intergenic
1116975579 14:51112029-51112051 CTCTGAATGGGAATGGTGGTAGG - Intergenic
1117059745 14:51949981-51950003 CTCTGAAAGGTCAAGGTGGGAGG - Intronic
1117203708 14:53418662-53418684 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1117303873 14:54454116-54454138 CTCTGCGAGGCCAATGTGGGTGG - Intergenic
1117386660 14:55221069-55221091 CTTTGAAAGGTCAAGGTGGGCGG + Intergenic
1117460572 14:55940795-55940817 CTTTGAAAGGGAAGTTTGGCAGG + Intergenic
1117642234 14:57812287-57812309 CTCTGAAAGGGAGGTGGGAGGGG - Intronic
1117683185 14:58226351-58226373 CTCTGGGAGGGCAAGGTGGGAGG - Intronic
1118191484 14:63584674-63584696 CTCTCAAAGAAAAATGAGGGTGG + Intergenic
1118227292 14:63913944-63913966 CTCTGGGAGGCAAAGGTGGGAGG - Intronic
1119450123 14:74702222-74702244 CTCTGCTAGGGCAATGTTGGGGG - Intronic
1119823092 14:77635476-77635498 CTCGGAGAGGGAGATGTGGCAGG + Intergenic
1119988963 14:79173284-79173306 CTTTGTAAGGCCAATGTGGGAGG + Intronic
1120044970 14:79795418-79795440 CTCCCACAGAGAAATGTGGGAGG - Intronic
1120132526 14:80823912-80823934 CTCTGCTAGGGCAATGTGGAAGG - Intronic
1120462600 14:84816048-84816070 CACAAAAAGGGGAATGTGGGTGG - Intergenic
1121297176 14:92837805-92837827 CTCTGAGAGGCCAAGGTGGGAGG - Intronic
1121366457 14:93316490-93316512 CTCTGAGAGGCCAAAGTGGGAGG - Intronic
1121840972 14:97133445-97133467 CTATGAAAGGGAAAATTTGGAGG - Intergenic
1121876920 14:97461303-97461325 CTTTGAAAGGCCAAAGTGGGTGG - Intergenic
1122559495 14:102601823-102601845 CTCTTGAAGGGAAATCTGAGTGG + Intronic
1122610834 14:102982328-102982350 CTGTGAGAGCGAACTGTGGGAGG + Intronic
1122885877 14:104710030-104710052 CTCTGGCAGGGACAGGTGGGGGG + Intronic
1123454494 15:20407719-20407741 CTCAGCAAGGGAGATTTGGGCGG - Intergenic
1123699602 15:22904309-22904331 CACTGAAAGGCACGTGTGGGTGG + Intronic
1123704595 15:22941869-22941891 CTTTGTCAGGGAAATGGGGGAGG - Intronic
1124332863 15:28835290-28835312 CTTTGAGAGGCCAATGTGGGAGG - Intergenic
1124414112 15:29460385-29460407 CTCTGGAAGGCCAAGGTGGGTGG + Intronic
1125552739 15:40559329-40559351 CTCTGAGAGGCCGATGTGGGAGG - Intronic
1126095447 15:45086243-45086265 CTTTGAAAGGCCAAAGTGGGTGG - Intergenic
1126256100 15:46627432-46627454 CTCTACTAGGGAAATGTGGAAGG + Intergenic
1126433820 15:48615019-48615041 CTCGGAAAGGAAAATGAGAGAGG + Intronic
1126841462 15:52721328-52721350 ATCTGAAAGGGAAACTGGGGAGG + Intergenic
1126964685 15:54038374-54038396 CTTTGAAAGGCAGAGGTGGGCGG - Intronic
1127441116 15:59009200-59009222 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
1128208505 15:65873831-65873853 CTCTGAGAGGCCAAGGTGGGAGG - Intronic
1128338045 15:66800945-66800967 CTCTGAAAGCCAAATGAGAGAGG - Intergenic
1129056209 15:72822193-72822215 GTCTGAAGGGGAAATGAGGTGGG + Intergenic
1129473433 15:75767469-75767491 CTTTGAAAGGCTGATGTGGGTGG + Intergenic
1129849850 15:78787418-78787440 CTCTGGGAGGCAAAGGTGGGCGG + Intronic
1129854984 15:78817175-78817197 CTTTGAGAGGGTAAGGTGGGAGG + Intronic
1129858385 15:78841278-78841300 TGCTGAAATGGAAATGTGTGTGG + Intronic
1129901028 15:79149615-79149637 CTCTGCTAGGGCAGTGTGGGAGG - Intergenic
1130072668 15:80661600-80661622 CTTTGAGAGGCCAATGTGGGTGG - Intergenic
1130327618 15:82893868-82893890 CTTTGAGAGGCTAATGTGGGAGG - Intronic
1130628227 15:85538315-85538337 CCCTCAAAGAGAAATTTGGGTGG + Intronic
1130904599 15:88231322-88231344 CTCTGGATGGGTGATGTGGGTGG - Intronic
1131134834 15:89926345-89926367 CTCTGAGAGGTGAAGGTGGGAGG + Intergenic
1131984974 15:98033849-98033871 CTCTGGAAGAGAAATGTAGCAGG - Intergenic
1134060058 16:11194027-11194049 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1135255452 16:20938146-20938168 CTTTGAAAGGCAGAGGTGGGTGG + Intronic
1135289357 16:21221986-21222008 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1135403501 16:22182191-22182213 CTCTGAAGGGGACATGTGGGAGG - Exonic
1135704274 16:24661229-24661251 CTCAGAAGGGGAAGGGTGGGAGG - Intergenic
1135707960 16:24691324-24691346 CTCTGAAAAGCCAAAGTGGGAGG - Intergenic
1135799607 16:25480358-25480380 CTCAGAAAGGGAGGGGTGGGTGG + Intergenic
1135941928 16:26829312-26829334 CTTTGAAAGGTCAAGGTGGGTGG + Intergenic
1136419853 16:30124999-30125021 CTCTGGGAGGCCAATGTGGGTGG - Intergenic
1136503685 16:30688681-30688703 CTCTGGAAGGCAGTTGTGGGTGG - Intergenic
1136575125 16:31118990-31119012 CTCTGAGAGGGTGAGGTGGGAGG - Intronic
1137270483 16:46899657-46899679 CTCTGCCAGGGAAATGAGGTGGG + Intronic
1137273444 16:46918124-46918146 CTCTGGCAGGGAAAAGTGGGTGG + Intronic
1137842429 16:51652840-51652862 TTCTGAATGGGAAATGAAGGAGG - Intergenic
1137851453 16:51749415-51749437 CTATGAAAGTGAAATATGAGTGG + Intergenic
1138239817 16:55418410-55418432 CTCTAAAAGGGAATGGAGGGAGG + Intronic
1138342280 16:56297923-56297945 CTCTGGGAGGCAAAGGTGGGCGG + Intronic
1139188237 16:64832675-64832697 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1139479916 16:67224871-67224893 CATTGAAAGGGGAATTTGGGAGG - Intronic
1139747475 16:69086405-69086427 CTTTGGAAGGCTAATGTGGGAGG - Intergenic
1139774147 16:69303574-69303596 CTGTGAAATGAAAGTGTGGGAGG + Exonic
1140321397 16:73955177-73955199 CACTGAAAGCTAAAGGTGGGTGG - Intergenic
1140466157 16:75184692-75184714 CTTTGGAAGGCCAATGTGGGTGG - Intergenic
1140928521 16:79605863-79605885 CCCTGAAAAGGCAAAGTGGGGGG - Intergenic
1142572873 17:886531-886553 CTTTGGAAGGCCAATGTGGGTGG + Intronic
1142791681 17:2271468-2271490 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1142843724 17:2655041-2655063 CTTTGAAAGGCCAATGCGGGAGG - Intronic
1143221226 17:5263799-5263821 CTCTGAAAGGCCCAGGTGGGTGG + Intergenic
1143611825 17:8022296-8022318 CTCTGAAAAGGCAATGAGGAGGG + Intergenic
1144485999 17:15664789-15664811 CTCTGGAAGGCCAAGGTGGGTGG + Intronic
1145227735 17:21144572-21144594 CTCTGAGAGGCCAAGGTGGGTGG + Intronic
1145977643 17:28993482-28993504 CTCTGAATGGAAAATCTTGGAGG + Intronic
1146161726 17:30563391-30563413 CTCGGAGAGGGAGATGTGGCAGG + Exonic
1146456589 17:33014065-33014087 CTCTGGAAGGGAAGGGTTGGTGG + Exonic
1146926875 17:36751497-36751519 CTTTGAAGGTGAAATGTGTGGGG - Intergenic
1146993305 17:37295543-37295565 CTTTGGGAGGTAAATGTGGGGGG + Intronic
1147257256 17:39189119-39189141 CTTTGAAAGGCTAAGGTGGGTGG + Intronic
1147273810 17:39297978-39298000 CTTTGAAAGGCTGATGTGGGTGG - Intronic
1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG + Intronic
1149219694 17:54402404-54402426 CTCTGAGAGGCTAAAGTGGGAGG - Intergenic
1149630932 17:58122572-58122594 GTCTGAAATCGAAATGTGTGAGG - Intergenic
1150540818 17:66097133-66097155 ATCTGAAAGGGAGATTTAGGGGG - Intronic
1150572474 17:66399322-66399344 CTCTGAGAAGCCAATGTGGGCGG - Intronic
1151001202 17:70378821-70378843 CTATGAATGGGAAAAGTGGAGGG + Intergenic
1151130144 17:71888608-71888630 CTCTGAAAGAGAAATGAGAAAGG - Intergenic
1151210066 17:72537842-72537864 CTTTGAGAGGGCAAGGTGGGCGG - Intergenic
1151611664 17:75180095-75180117 CTCTGAGAGGCCAAGGTGGGCGG + Intergenic
1151623194 17:75259904-75259926 CTTTGTAAGGGAAAGGTGGGAGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152815368 17:82404594-82404616 CTCTGAAATGGATGTCTGGGTGG + Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1153992445 18:10412429-10412451 CTCTAAAAGGATGATGTGGGTGG + Intergenic
1155250402 18:23948317-23948339 TCCTGAAAAGGATATGTGGGAGG - Intronic
1155288126 18:24312890-24312912 CTCTGGGAGGGCAAGGTGGGCGG + Intronic
1155547131 18:26927462-26927484 CTCTGAGAGGGGGATGTGGCAGG + Intronic
1155591865 18:27436462-27436484 CTCTGGGAGGCCAATGTGGGTGG - Intergenic
1155795808 18:30035301-30035323 CTCTGCTAGGGAAGTGTGGCAGG + Intergenic
1155848800 18:30744426-30744448 CTCTGAGAGGCAAAGGCGGGAGG + Intergenic
1155979264 18:32163830-32163852 ATCTGAAAGGATAATGTGGTAGG + Intronic
1156887841 18:42156292-42156314 CTCTGAAAGGGATATCTGGATGG - Intergenic
1157427089 18:47593432-47593454 GTCTGAAAGTGAAATGAGGCAGG - Intergenic
1157942295 18:51942543-51942565 CCCTGAAAGGGAAATTTGCCAGG - Intergenic
1158556476 18:58479396-58479418 CTCTGGAAGGCCAAGGTGGGTGG - Intergenic
1158725078 18:59963947-59963969 CTTTGAGAGGCAAAGGTGGGAGG - Intergenic
1159183576 18:64942758-64942780 CTCTGAAGGGGGAATGAGGTGGG - Intergenic
1159336680 18:67076982-67077004 CTCTGAGAGGGGGATGTGGCAGG + Intergenic
1159477515 18:68942466-68942488 CTCAGAGAGGGGAATGTGGCAGG + Intronic
1159773872 18:72582167-72582189 CTCTTAGAGAAAAATGTGGGAGG - Intronic
1159811833 18:73025906-73025928 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1160100951 18:75918552-75918574 CTGTGAAAGGGATGTGTAGGTGG - Intergenic
1161212014 19:3071724-3071746 CTCTGGAAGGCCAAGGTGGGAGG - Intergenic
1161343785 19:3757348-3757370 CTTTGAAAGGCTGATGTGGGAGG - Intronic
1161473260 19:4471978-4472000 AGGTGAAAGGGAAAGGTGGGAGG - Intergenic
1161844416 19:6704032-6704054 CTCTGAGAGGCCAAGGTGGGAGG + Intronic
1161872369 19:6880110-6880132 ACCTGAAAGGGAATTATGGGGGG + Intergenic
1162108102 19:8383102-8383124 CTTTGATAAGGAAATGTGGTGGG - Intronic
1162776131 19:12980745-12980767 CTCTGAAAGGCCAAGGTGTGTGG - Intergenic
1163060545 19:14758052-14758074 CTTTGGAAGGCCAATGTGGGCGG - Intronic
1163468015 19:17480619-17480641 CTTTGAAAGGTCAAGGTGGGAGG - Intronic
1163601081 19:18249516-18249538 CTTTGGAAGGCAAAGGTGGGTGG - Intronic
1163706781 19:18819066-18819088 CTTTGAGAGGCAAAGGTGGGAGG - Intergenic
1163898863 19:20083082-20083104 CTCAGAGAGGGAGATGTGGCAGG - Intronic
1164647293 19:29868686-29868708 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1165455054 19:35905709-35905731 CTTTGGGAGGGAAAGGTGGGCGG + Intronic
1165530478 19:36396147-36396169 CTTTGAAAGGCAGAGGTGGGAGG - Intronic
1165547102 19:36548775-36548797 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1166405852 19:42521487-42521509 GTCTGAAGGGGAAATGGTGGGGG + Exonic
1166415010 19:42589004-42589026 GTCTGAAGGGGAAATGGTGGGGG + Exonic
1166416306 19:42596672-42596694 GACTGGAAGGGAAGTGTGGGTGG + Intronic
1166769379 19:45271767-45271789 CTCTGCAGGGGAGGTGTGGGGGG - Intronic
1167635150 19:50649922-50649944 CTGTGGGAGGGAATTGTGGGAGG - Intronic
1167883783 19:52484048-52484070 CTCAGAGAGGGGAATGTGGCAGG + Intronic
1167925543 19:52818467-52818489 CTCTGAAAGGCCGAGGTGGGTGG + Intronic
1167929787 19:52854779-52854801 CTCTGAAAGGCCAAGGTGGGTGG + Intronic
1167937160 19:52918524-52918546 CTCTGGAAGGCCAAGGTGGGTGG + Intergenic
1167992414 19:53371610-53371632 CTCTGGAAGGCCAAGGTGGGTGG - Intronic
925208587 2:2027402-2027424 CTCTGAAAGGGAGATTCGGTTGG + Intronic
925575444 2:5355538-5355560 CTCTGGAAGGCCAAGGTGGGTGG + Intergenic
926009437 2:9396518-9396540 CTCTGAAAGGCCAAGGTGGGAGG - Intronic
926565074 2:14459814-14459836 CTCTGAGGGGGAAATGAGGTAGG + Intergenic
926695910 2:15770199-15770221 CTCTGAAAGAGAAATGGAAGGGG - Intergenic
926754436 2:16223989-16224011 TTCTGAAAGGCAAATGTGCTAGG + Intergenic
927051556 2:19335071-19335093 CTCTGGAAGGCCAAAGTGGGAGG + Intergenic
928465599 2:31519793-31519815 CTCTGATAGGGCAGTGTGGAAGG + Intergenic
928839063 2:35583934-35583956 CTCTGAGAGGGGAATGAGGTAGG - Intergenic
929162536 2:38846927-38846949 CTTTGGAAGGCAAAGGTGGGAGG - Intronic
929459061 2:42088223-42088245 CTTTGGAAGGCCAATGTGGGCGG + Intergenic
929752671 2:44732195-44732217 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
929766908 2:44851741-44851763 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
929785078 2:44983789-44983811 CTTTGGAAGGGTGATGTGGGAGG + Intergenic
929976970 2:46644301-46644323 CTCTGGGAGGGCAAGGTGGGTGG + Intergenic
930193460 2:48484088-48484110 TTCTGAAAGGAATGTGTGGGTGG - Intronic
930666159 2:54100829-54100851 CTATGAATGGGAAATGAGGCTGG + Intronic
930819115 2:55627521-55627543 CTCTGGAAGGCCAAGGTGGGAGG + Intergenic
931119845 2:59204102-59204124 TTCAAAAAGGGAATTGTGGGTGG - Intergenic
931670374 2:64641912-64641934 TGCTGAAAGAGAAATATGGGAGG - Intronic
932108128 2:68967771-68967793 CTCTGAGAGGCCAAGGTGGGTGG + Intergenic
932233991 2:70106503-70106525 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
932326592 2:70866433-70866455 CTTTGAGAGGCAGATGTGGGAGG - Intergenic
932846671 2:75142461-75142483 CTCTGAAAATCAAATGTGGTGGG + Intronic
932923324 2:75942083-75942105 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
933055490 2:77658009-77658031 GTCTGTAAGTGAAATGTGTGGGG - Intergenic
933674783 2:85045001-85045023 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
933874414 2:86604310-86604332 GTCTGAAGAGGAAATGTCGGAGG - Exonic
934183998 2:89655123-89655145 CTTTGAGAGGCAAAGGTGGGAGG + Intergenic
934294289 2:91729288-91729310 CTTTGAGAGGCAAAGGTGGGAGG + Intergenic
934501101 2:94861160-94861182 CTCTGAATGGGATATTTTGGCGG - Intergenic
934954111 2:98602413-98602435 CTCTGGGAGGGAGAGGTGGGTGG + Intronic
935100339 2:99988615-99988637 CTCTGAAAGGAGATTGTAGGAGG - Intronic
935197981 2:100831640-100831662 CTATGAAGGGGAAAGGGGGGAGG - Intronic
935296630 2:101655451-101655473 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
935593017 2:104857724-104857746 CTCTGAAATGGGAAGGAGGGGGG + Exonic
936482893 2:112901543-112901565 TTCAGAAAAGGAAATGTGGCAGG + Intergenic
936736207 2:115446293-115446315 CTCTGCTAGGGAAATGTGGAAGG + Intronic
937278592 2:120702299-120702321 CTCTGAGAGGGGAGTGAGGGTGG + Intergenic
937505858 2:122535751-122535773 CTCTTAAAGGGAAATCGGGGTGG - Intergenic
938298082 2:130190929-130190951 CACTTGAAGTGAAATGTGGGAGG + Intergenic
938861488 2:135374161-135374183 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
939306084 2:140414157-140414179 CTTTGAAAGGTAAAGGTGGGAGG - Intronic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
940071611 2:149694644-149694666 CTGTGAAAGTGAAATGAGGCTGG + Intergenic
941357552 2:164512042-164512064 CTCTGCCAGTGAAAAGTGGGGGG + Intronic
941797290 2:169613683-169613705 CTTTGAAAGGTCAAAGTGGGAGG + Intronic
942013891 2:171791735-171791757 ATGTGCAAGGGAAATGGGGGAGG + Intronic
942058672 2:172207897-172207919 CTCTGAGAGGGACTTGTTGGTGG + Intergenic
942501277 2:176593308-176593330 ATCTGAAAGAGAATTGTGGGAGG + Intergenic
942601362 2:177644059-177644081 CTCTGCTAGGGCAGTGTGGGAGG + Intronic
942715020 2:178882126-178882148 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
942976410 2:182023877-182023899 CTCTGAGAGGCCAAGGTGGGAGG - Intronic
942993716 2:182235383-182235405 CTTTGAGAGGCCAATGTGGGCGG - Intronic
943045547 2:182857375-182857397 CTCTGTAAGGCCAAGGTGGGTGG + Intronic
944294507 2:198047423-198047445 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
945743898 2:213697200-213697222 ATTTGAAAGGGAAGAGTGGGTGG + Intronic
946214135 2:218170568-218170590 CTTTGAGAGGCCAATGTGGGAGG + Intergenic
946349975 2:219143955-219143977 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
947005521 2:225506829-225506851 ACCTGAAAGGGAAATGGTGGTGG - Intronic
947076410 2:226350374-226350396 CTCTGAAGGGTAAATAAGGGTGG + Intergenic
947784860 2:232807813-232807835 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
947985665 2:234445650-234445672 CTCTGGAAGGCCAAGGTGGGCGG - Intergenic
1169009929 20:2242081-2242103 CTCTGAGAGGCCAAGGTGGGCGG + Intergenic
1169338540 20:4777313-4777335 TTTTGAAAGGGTAAGGTGGGTGG - Intergenic
1169423890 20:5481467-5481489 CTCTCAGAGGGAAATGAGGCAGG - Intergenic
1169766777 20:9155098-9155120 CTCAGAAGGGGAAGGGTGGGAGG - Intronic
1170668789 20:18410701-18410723 CTCTGGAAGGCTAAGGTGGGAGG + Intronic
1171347001 20:24473007-24473029 GTCTGAAAGGCCAATGTGAGGGG - Intronic
1171517916 20:25752116-25752138 CTCTGAAAGGGAATGGAGGGTGG + Intergenic
1171844851 20:30261377-30261399 CTTTGAGAGGGCAAGGTGGGTGG - Intergenic
1171900295 20:30850110-30850132 CTCTGAGAGGGGGATGTGGTAGG + Intergenic
1172337354 20:34128311-34128333 CTCAGCAAGGGGAATGTGGCGGG - Intergenic
1172397413 20:34618536-34618558 CTTTGAAAGGCAAAGGTGGGAGG + Intronic
1172726467 20:37046854-37046876 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1172948616 20:38707308-38707330 CTTTGAAAGGCCAAGGTGGGCGG - Intergenic
1173073271 20:39790885-39790907 CACTGTAAGGGCAAGGTGGGAGG + Intergenic
1173292088 20:41724047-41724069 CTCTGAGAGGCCAAGGTGGGCGG - Intergenic
1173526737 20:43738525-43738547 CTTTGGAAGGGTAAGGTGGGTGG + Intergenic
1174125867 20:48305565-48305587 CTCTGAGAGGCCAAGGTGGGTGG + Intergenic
1174479872 20:50823576-50823598 CTCTGAGAGGACAAAGTGGGAGG + Intronic
1174620724 20:51872560-51872582 CTTTGAGAGGCCAATGTGGGCGG - Intergenic
1174771181 20:53301948-53301970 CCTTGAAAAGGAAAAGTGGGGGG + Intronic
1175351776 20:58327061-58327083 CTCTGGAAGGCCAATGTGGGAGG + Intronic
1175461303 20:59153612-59153634 CTATGAAGGGCAAATGTGGTTGG + Intergenic
1175743915 20:61440352-61440374 CTCTGAAAGGCAAATGTAAAGGG + Intronic
1175889668 20:62310611-62310633 AGCTGAAAGGGAACAGTGGGTGG + Intronic
1176984774 21:15422986-15423008 CTCAGAAAGAGGAGTGTGGGAGG + Intergenic
1177169813 21:17642584-17642606 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1177339757 21:19783820-19783842 CTCTGACAGGGCAGTGTGGAAGG - Intergenic
1177606050 21:23379054-23379076 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1178042992 21:28662164-28662186 CTCTGAAAGGGAAATGAGGGTGG + Intergenic
1178253424 21:31028114-31028136 CTTTGGAAGGCCAATGTGGGAGG - Intergenic
1178504087 21:33149246-33149268 CTCGGAAAGGCAAATGGGTGTGG - Intergenic
1178576638 21:33798341-33798363 CTCTGAAAGGCCAAGGTGGGAGG - Intronic
1178918843 21:36725100-36725122 CTTTGGAAGGCTAATGTGGGAGG + Intronic
1179413578 21:41180321-41180343 CTCTGAAGGGGGAATGAGGTAGG - Intronic
1180060627 21:45383189-45383211 CTCTGAAAGGGAGCTCAGGGAGG + Intergenic
1181063450 22:20293253-20293275 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1181153250 22:20900419-20900441 CTTTGAAAGGCAGAGGTGGGAGG - Intergenic
1183736930 22:39649480-39649502 CTCTGAAAAGCAAATGAGAGGGG - Exonic
1184360411 22:44013969-44013991 CTCTGGGAGGCTAATGTGGGTGG + Intronic
1184480048 22:44741061-44741083 CTTTGAGAGGGCAAGGTGGGTGG + Intronic
949524139 3:4886784-4886806 CTCTGGAAGGCCAAGGTGGGAGG - Intronic
949543849 3:5055280-5055302 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
949622466 3:5829624-5829646 CTCCTAAAGAGAAATGAGGGAGG - Intergenic
949662156 3:6291838-6291860 CTCTGCAAGGGCAGTGTGGAAGG - Intergenic
950810360 3:15645027-15645049 ATCTCAGAGTGAAATGTGGGAGG - Exonic
951161956 3:19434379-19434401 CTGTGTAAGGGAGATGAGGGTGG - Intronic
951544929 3:23815223-23815245 CTCTGGAAGGGCAAAGTGGGTGG - Intronic
951842556 3:27049637-27049659 CGCTGAAAGGGAGATGTTGGGGG - Intergenic
951888428 3:27547049-27547071 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
952006643 3:28848914-28848936 CTCTGAAAGGGGACTGTTGTAGG + Intergenic
952242837 3:31551458-31551480 CTCTGAGAGGCCAAGGTGGGTGG - Intronic
952543341 3:34391730-34391752 CTCCAAATGGGGAATGTGGGAGG + Intergenic
952773280 3:37021458-37021480 ACCTGAAAGGGATATGTGGCAGG + Intronic
954165335 3:48752697-48752719 CTCTTAAAAAAAAATGTGGGGGG - Intronic
954347048 3:50008792-50008814 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
954643473 3:52116259-52116281 CCCAAAAATGGAAATGTGGGAGG + Intronic
954759551 3:52864141-52864163 CTCTGCTAGGGCAATGTGGAAGG - Intronic
955310462 3:57881318-57881340 CTCTGAAGGGGTAAAGTGAGAGG + Intronic
956759694 3:72429608-72429630 CTCTGGAAGGCCAAAGTGGGAGG + Intronic
957268252 3:77995632-77995654 CACGGAAAGGTAAATGTGGTTGG - Intergenic
958102407 3:89030001-89030023 CTTTGGAAGGCCAATGTGGGTGG - Intergenic
958430152 3:94030473-94030495 CTCTGGGAGGCCAATGTGGGTGG - Intronic
958481637 3:94651931-94651953 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
959296275 3:104538471-104538493 CTGTAAAAGGGATATTTGGGAGG - Intergenic
959526256 3:107380790-107380812 CTGTGTAAGGGACATGTGAGGGG - Intergenic
959634887 3:108554702-108554724 CTATGAAATAGAAATGTGTGGGG + Intronic
960419445 3:117425903-117425925 CTTTGAAAGGCAATTGTGGGAGG - Intergenic
961067776 3:123890867-123890889 CTCTGCTAGGGCAGTGTGGGAGG - Intergenic
961583121 3:127899535-127899557 TGCTGAAGGGGGAATGTGGGTGG + Intergenic
961690478 3:128665954-128665976 CTCTGCAAGGCCAAGGTGGGCGG - Intronic
961846825 3:129772113-129772135 CTTTGGAAGGCCAATGTGGGAGG + Intronic
962635262 3:137324928-137324950 CACTGAGAGGAAAAGGTGGGAGG - Intergenic
962778482 3:138687696-138687718 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
962833080 3:139161155-139161177 CTCTGAGATGGAAATGCGGGAGG + Intronic
962922198 3:139960327-139960349 CTCTGAAAGGGAAATGTGGGGGG - Intronic
963260797 3:143189084-143189106 CTCCCAAGGGAAAATGTGGGAGG - Intergenic
963468151 3:145709449-145709471 CTCTGAGAGGGGGATGTGGCAGG + Intergenic
964041721 3:152269071-152269093 CTCTGAAAAAAAAATGTGAGAGG + Exonic
965066648 3:163858171-163858193 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
965577462 3:170232292-170232314 CTTTGAAAGGCCAATGTGGGAGG - Intronic
966071757 3:175886319-175886341 ATCTGACAAAGAAATGTGGGCGG - Intergenic
966817429 3:183900627-183900649 CTCTGGAAGGCCAAGGTGGGAGG + Intergenic
966877406 3:184330981-184331003 CTCTGAAAGGTCGAGGTGGGCGG - Intronic
966981309 3:185138854-185138876 CTCTGAGAGGCCAAGGTGGGAGG + Intronic
967302571 3:188030207-188030229 CTCTGATATTGACATGTGGGAGG - Intergenic
967505238 3:190246023-190246045 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
967609175 3:191483366-191483388 CTCTGCTAGGGCAGTGTGGGAGG + Intergenic
967810420 3:193755199-193755221 CTCTGCTAGGGAAGTGTGGAAGG + Intergenic
967883076 3:194315317-194315339 CCCAGAAAGGGAAAGGTGAGAGG + Intergenic
968396324 4:241975-241997 CTCAGCAAGGGGAATGTGGCAGG - Intergenic
968417943 4:456635-456657 CTTTGAGAGGCCAATGTGGGCGG + Intronic
968772886 4:2519522-2519544 CTTTGAGAGGCAGATGTGGGAGG + Intronic
969070691 4:4535961-4535983 CTCTGAAAAGGAAATCAAGGAGG + Intronic
969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG + Intronic
970316209 4:14830652-14830674 CTTTGAGAGGCCAATGTGGGTGG - Intergenic
970756867 4:19437458-19437480 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
971026905 4:22597990-22598012 CTCGGAGAGGGGAATGTGGCAGG + Intergenic
971758839 4:30737407-30737429 CTTTGAGAGGCAAATGTGGGAGG + Intronic
971838242 4:31797539-31797561 CTCTGAGAGGCCAAGGTGGGTGG - Intergenic
971939807 4:33200062-33200084 CTCTGATAGGGTAGTGTGGAAGG + Intergenic
972287315 4:37661521-37661543 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG + Intronic
973748499 4:53987848-53987870 CTCTGAAAAGTGAATGTCGGGGG - Intronic
973778526 4:54266488-54266510 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
974174682 4:58307993-58308015 CTTTGAAAAGGAAAAGTGGTGGG - Intergenic
974909784 4:68103195-68103217 CTTTGAAAGGCCAAAGTGGGTGG + Intronic
975157815 4:71091189-71091211 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
975694479 4:76998280-76998302 CTGTGAAATGGAAATGGGGGTGG - Intronic
975771832 4:77732959-77732981 ATCTGAAAGAGAAATGATGGTGG + Intronic
976144933 4:82032958-82032980 CTCTGAAAGGGCACTGTAGCAGG + Intronic
976503115 4:85814839-85814861 CTCTGCTAGGGCAATGTGGAAGG - Intronic
976934772 4:90616435-90616457 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
977670140 4:99685627-99685649 CTCTGCTAGGGCAGTGTGGGAGG + Intergenic
977707633 4:100088991-100089013 CTCAGAACGGGAAGGGTGGGAGG - Intergenic
977852672 4:101848895-101848917 CGCTGAAAGGGAGAGGTGGGAGG - Intronic
977884261 4:102238941-102238963 CTTTGAAAAGGAAAAGTGGTGGG - Intergenic
978058064 4:104297938-104297960 CTCTCAAAGAGAAATGATGGTGG + Intergenic
978904072 4:113985580-113985602 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
979014591 4:115417907-115417929 CACTGAAAAGGAAAGGTGGCAGG - Intergenic
980030463 4:127823390-127823412 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
981175929 4:141683325-141683347 CTTTGGAAGGGCAAGGTGGGTGG + Intronic
981407195 4:144385430-144385452 CTCTGCTAGGGAAGTGTGGAAGG - Intergenic
982436747 4:155389019-155389041 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
982454675 4:155594522-155594544 CTTTGAGAGGGAGAGGTGGGAGG + Intergenic
982504915 4:156205455-156205477 CTCTGTTAGGGAAATGCGGAAGG - Intergenic
982872277 4:160596219-160596241 CTCTTAAAGAGGAATTTGGGCGG - Intergenic
983147531 4:164235728-164235750 CTCAGAAGGGGAAGAGTGGGAGG + Intronic
983353644 4:166627954-166627976 CTTTGAGAGGCAAAGGTGGGTGG + Intergenic
983610619 4:169641011-169641033 GACTGAGAGGGAAATGTGAGAGG + Intronic
984292595 4:177814107-177814129 CTCTGAAAGGGGAATCTGGCAGG - Intronic
984549688 4:181145600-181145622 CTCTGAGAGGGAAATCTAGTAGG - Intergenic
985225038 4:187751137-187751159 CTCTGATAGGGAAATGCAGAAGG + Intergenic
986391645 5:7292803-7292825 CTTTGAGAGGCCAATGTGGGAGG - Intergenic
986549456 5:8936271-8936293 CTCTAACAGGGAAGTGTTGGGGG - Intergenic
986594868 5:9410896-9410918 CTCTGTTATGGAAATGTAGGCGG - Intronic
986756734 5:10843855-10843877 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
987812293 5:22853315-22853337 ATCTGAAGGGTAAATGTGGAGGG - Exonic
987895646 5:23942995-23943017 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
988037230 5:25842856-25842878 CTTTGGAAGGTAAAGGTGGGAGG - Intergenic
988129103 5:27080036-27080058 CTCTGCTAGGGAATTGTGGAAGG - Intronic
988458629 5:31411868-31411890 CTTTGAAAGGTCAAGGTGGGTGG - Intronic
988719068 5:33858411-33858433 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
988924562 5:35976594-35976616 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
989032794 5:37136602-37136624 CTCTGCTAGGGCAGTGTGGGAGG - Intronic
990193281 5:53286219-53286241 GTGTGGAAGGGAAATATGGGTGG - Intergenic
990844554 5:60122323-60122345 CTCTGCTAGGGAAGTGTGGAAGG - Intronic
991535943 5:67669414-67669436 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
992487132 5:77208648-77208670 GCCTGGAAGGGAACTGTGGGTGG + Intergenic
992564046 5:77980585-77980607 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
992669219 5:79042185-79042207 ATGCAAAAGGGAAATGTGGGAGG - Intronic
993067643 5:83119726-83119748 CTTTGGAAGGCCAATGTGGGAGG + Intronic
993205127 5:84868996-84869018 CTCTAAAAGTAAAATGTGGCTGG + Intergenic
993642421 5:90421401-90421423 CTCTTGAAGGGAAATCTGAGCGG + Intergenic
993654864 5:90564989-90565011 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
994231565 5:97314633-97314655 CTTTGAAAAGGAAAAGTGGTGGG + Intergenic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
994524222 5:100882943-100882965 CTCTGCAAGGGCAGTGTGGAAGG + Intronic
994907706 5:105862146-105862168 CTCTGAAGGAGAAGTGTGGGAGG - Intergenic
995147793 5:108806339-108806361 CTCTGCTAGGGCAATGTGGAAGG + Intronic
995667355 5:114557661-114557683 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
996066231 5:119082516-119082538 CTCTGGGAGGCCAATGTGGGAGG - Intronic
996396467 5:123018533-123018555 CTCTGAAAAGTTAATGGGGGTGG + Intronic
996857866 5:128030299-128030321 CTTTGGGAGGGAAAAGTGGGAGG + Intergenic
996909206 5:128635957-128635979 CTTTGATAGGGAAATTTGGAAGG + Intronic
997057317 5:130460010-130460032 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
997108221 5:131045815-131045837 CTCTGTTAGGGAAATGGAGGAGG - Intergenic
997333863 5:133089768-133089790 CTTTGAAAGGCTAAGGTGGGAGG + Intronic
997370537 5:133356940-133356962 ACCTGAAATGGAAAAGTGGGTGG - Intronic
997465569 5:134085642-134085664 CTCCGGAAGGCAAAGGTGGGAGG + Intergenic
997691598 5:135831117-135831139 CTCTGTGGGGGAAATGTGGCTGG + Intergenic
997900069 5:137755290-137755312 CTCTGAGAGGGCATCGTGGGAGG - Intergenic
998189390 5:140010052-140010074 CTCTGAGAGGCCAAGGTGGGTGG + Intronic
998343909 5:141443721-141443743 CACTGATAGGGAAATGTATGAGG - Intronic
999171209 5:149596863-149596885 CTGTGAAGGGGAAATGAGGTTGG + Intronic
999763143 5:154718302-154718324 ATCAGAGATGGAAATGTGGGTGG + Intronic
1000527194 5:162372106-162372128 CTCTAAAAGGGTGTTGTGGGAGG - Intergenic
1001613506 5:173023098-173023120 CTCTGGAAGGCCAAAGTGGGAGG - Intronic
1002165848 5:177345095-177345117 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1002214716 5:177622185-177622207 CTCTGGGAGGCAAAGGTGGGAGG + Intergenic
1003681560 6:8262524-8262546 CACAGAAAGGGAAATCTGGAGGG - Intergenic
1004300356 6:14452152-14452174 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1005025652 6:21460671-21460693 CTCTGGGAGGGCAAGGTGGGTGG + Intergenic
1005218900 6:23563505-23563527 CTCTGAAAGGGAAGTGGGTGGGG + Intergenic
1005533208 6:26729314-26729336 GCCTGAAAAGGAAATGTGGTTGG - Intergenic
1005537586 6:26772350-26772372 GCCTGAAAAGGAAATGTGGTTGG + Intergenic
1005901611 6:30221528-30221550 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1005921740 6:30407715-30407737 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1006123965 6:31825813-31825835 GTCTGAAAGGAAAATGTGAGGGG - Intergenic
1006238519 6:32657325-32657347 CTCGGAGAGGGAGATGTGGCAGG + Intergenic
1006240423 6:32673036-32673058 CTCTGATAGGGCAGTGTGGAAGG + Intergenic
1006503756 6:34475011-34475033 CTCTGAGGGGGTGATGTGGGTGG - Intronic
1007040360 6:38715754-38715776 CTCAGAAGGGGAAGGGTGGGAGG + Intronic
1007077229 6:39075496-39075518 CTCTGAGTGGGAGATGGGGGAGG + Intronic
1007216743 6:40246099-40246121 TTCTGAGAGGAAAATGGGGGAGG - Intergenic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1009008461 6:57814760-57814782 GCCTGAAAAGGAAATGTGGTTGG + Intergenic
1009033546 6:58089753-58089775 CTCTGAGAGGCCAAGGTGGGTGG + Intergenic
1009328860 6:62389289-62389311 CTCTGACAGGGACAAGTGGGTGG + Intergenic
1009532868 6:64843203-64843225 CTCTGCTAGGGCATTGTGGGAGG + Intronic
1009717618 6:67420450-67420472 CTTTGGAAGGCCAATGTGGGAGG + Intergenic
1009934191 6:70214044-70214066 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1010828987 6:80507974-80507996 ATCTGAAAGGGAGATATAGGTGG - Intergenic
1011678529 6:89759826-89759848 CTCTGGAAGGCCAAGGTGGGTGG + Intronic
1011784245 6:90826471-90826493 CTCTGCTAGGGAAGTGTGGAAGG + Intergenic
1012264923 6:97130004-97130026 CTGATAAAAGGAAATGTGGGTGG + Intronic
1012306839 6:97669202-97669224 CTGGGAAAGGGAACTGGGGGAGG - Intergenic
1012441384 6:99265164-99265186 CTTTGATAAGGAAATGTGGTGGG + Intergenic
1012826348 6:104151531-104151553 CTCTGATAGGGCAGTGTGGAAGG - Intergenic
1012959790 6:105610182-105610204 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1013083990 6:106840184-106840206 CTCTGGGAGGCCAATGTGGGAGG - Intergenic
1013136956 6:107291607-107291629 CTCTGGAAGGCCAAGGTGGGAGG - Intronic
1014028407 6:116674465-116674487 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1014267981 6:119303261-119303283 CTCTGGAAGGCCAAAGTGGGAGG - Intronic
1014518948 6:122414858-122414880 CTTTGAAAGGCCGATGTGGGCGG - Intronic
1014617634 6:123623429-123623451 CTCTGATAGGAAAATTTTGGGGG + Intronic
1015017745 6:128434774-128434796 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1015677080 6:135762264-135762286 CTCTGCTAGGGCAATGTTGGAGG - Intergenic
1015942710 6:138467989-138468011 CTCTGAGAGGCCAAGGTGGGAGG - Intronic
1016336290 6:143008500-143008522 GATTGAATGGGAAATGTGGGGGG - Intergenic
1016790201 6:148060004-148060026 CTCTGCAAGGGCAATGTGAAAGG - Intergenic
1016973143 6:149783936-149783958 CTCTGAAAGGCCAAAGTGGAAGG - Intronic
1017106485 6:150893306-150893328 CTTTGAGAGGGCCATGTGGGTGG - Intronic
1017625906 6:156348537-156348559 GACAGAAAGGGAAATGTGTGTGG + Intergenic
1017816370 6:158019335-158019357 TTCTGAAAGGGACAGGTGGCTGG + Intronic
1018997570 6:168721736-168721758 CTCTGAAATCTAAGTGTGGGCGG - Intergenic
1019343888 7:520459-520481 CTCCCAAGTGGAAATGTGGGTGG - Intergenic
1019430172 7:995451-995473 GTCAGAAAGGGAAATGGGGTGGG - Intergenic
1019778619 7:2926907-2926929 TTCTGAGAGGGCAGTGTGGGTGG + Intronic
1020046852 7:5046553-5046575 CGCTGCATGGGAAATCTGGGAGG + Intronic
1020237262 7:6366020-6366042 CTTTGAAAGGGCGAGGTGGGTGG + Intergenic
1021704331 7:23351772-23351794 GTCTCAAAGGAAAATGTGTGTGG - Intronic
1021871936 7:25015615-25015637 CTCTGAAAGGGATGTTGGGGAGG - Intergenic
1022465338 7:30649581-30649603 CTGTGAATGGGAAATGATGGAGG + Intergenic
1023393950 7:39734996-39735018 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
1024579589 7:50791395-50791417 TTCTGAAAGGGAAATGGCGTGGG - Intronic
1024843977 7:53620609-53620631 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1025064594 7:55842361-55842383 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1025096771 7:56102058-56102080 CTCTGGAAGGCCAAGGTGGGAGG - Intronic
1025187966 7:56875661-56875683 CTCAGCAAGGGAACTCTGGGTGG + Intergenic
1025210232 7:57016177-57016199 CTTTGGAAGGGCAAAGTGGGTGG - Intergenic
1025293309 7:57751547-57751569 CTTTGGGAGGGAAAGGTGGGTGG - Intergenic
1025661721 7:63560670-63560692 CTTTGGAAGGGCAAAGTGGGTGG + Intergenic
1025683956 7:63701263-63701285 CTCAGCAAGGGAACTCTGGGTGG - Intergenic
1025745079 7:64235543-64235565 CTTTGAAAGGCCGATGTGGGTGG + Intronic
1025934250 7:66021952-66021974 CTTTGAAAGGCTAAGGTGGGTGG + Intergenic
1026051993 7:66954638-66954660 CTTTGAGAGGCCAATGTGGGTGG - Intronic
1026349154 7:69500585-69500607 CTTTGGAAGGCCAATGTGGGAGG + Intergenic
1026815648 7:73509474-73509496 CTTTGAAAGGCACAGGTGGGAGG + Intronic
1026905218 7:74059112-74059134 CTTTGAGAGGCCAATGTGGGAGG - Intronic
1026990287 7:74581263-74581285 CTTTGAGAGGCCAATGTGGGTGG - Intronic
1027197979 7:76044391-76044413 CTCTGGAAGGCCAAGGTGGGAGG - Intronic
1027515908 7:79141359-79141381 ATTTGAAAGGGAAAACTGGGAGG - Intronic
1027655899 7:80930447-80930469 CCATGAAAGGGGAGTGTGGGGGG - Intergenic
1027917434 7:84343569-84343591 CTCTCTAAGGGAAATGTGTCTGG + Intronic
1027923345 7:84426069-84426091 CTCAGGAAGGGAAGGGTGGGAGG + Intronic
1028844175 7:95461079-95461101 GTGCAAAAGGGAAATGTGGGGGG + Intergenic
1029248683 7:99220759-99220781 CTTTGGAAGGCAAAGGTGGGAGG - Intergenic
1029374038 7:100167282-100167304 GTCTAGAAGGGAAATGAGGGGGG + Exonic
1029682457 7:102121125-102121147 GTCTGCATGGCAAATGTGGGTGG + Intronic
1029803894 7:102976650-102976672 CTCTTTAAGGGTAATGTGGACGG - Intronic
1029878788 7:103783236-103783258 CTTTGAGAGGGCAAGGTGGGAGG - Intronic
1030324021 7:108200976-108200998 GTCTCAAAGGAAAGTGTGGGGGG + Intronic
1030343362 7:108405873-108405895 CTCTGGAAGGCCAAGGTGGGAGG + Intronic
1030434354 7:109497110-109497132 CTTTGAGAGGCAAAGGTGGGAGG - Intergenic
1030616403 7:111742557-111742579 GTGGGAGAGGGAAATGTGGGGGG - Intronic
1030784261 7:113640823-113640845 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1030912590 7:115270363-115270385 CTTTGAGAGGGTAAGGTGGGAGG - Intergenic
1030935082 7:115575806-115575828 CTTTGAAAGAGAAATATGGCTGG + Intergenic
1031146589 7:118003735-118003757 CTGTGATAGGGAACTGTGTGGGG - Intergenic
1031322892 7:120355301-120355323 CTTTGAGAGGCAGATGTGGGTGG + Intronic
1031552685 7:123134134-123134156 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1031654602 7:124338266-124338288 CTCTGAGAGGCCAGTGTGGGAGG - Intergenic
1031726495 7:125246451-125246473 CACTGAGAGGCAAAGGTGGGAGG + Intergenic
1031909505 7:127500253-127500275 CTCTGAGAGGCCAAGGTGGGAGG - Intergenic
1033454967 7:141494658-141494680 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1034095902 7:148407458-148407480 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1034488616 7:151381357-151381379 CCCTAAAAGGGAAAAGGGGGCGG + Exonic
1034579815 7:152032633-152032655 CTTTGATAAGGAAATGTGGTGGG + Intronic
1034616202 7:152418948-152418970 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1034684577 7:152958945-152958967 CTCTGCAGGGGAGATGGGGGAGG - Intergenic
1035180343 7:157084863-157084885 CTCTACTAGGGCAATGTGGGAGG + Intergenic
1035427259 7:158787488-158787510 CTCTGGAAGGGAGAAGAGGGAGG + Intronic
1035928606 8:3757044-3757066 CTCTGAGAGGCAAAGGTGAGAGG - Intronic
1037365231 8:18115130-18115152 CTCTAACAGAGAAATGTGGGAGG + Intergenic
1037640341 8:20736505-20736527 CCCTGGCATGGAAATGTGGGTGG + Intergenic
1037689651 8:21171291-21171313 CTCTGAGAGAGAAGTGTGGAGGG - Intergenic
1038340744 8:26683175-26683197 CTCGGAGAGGGGAATGTGGCAGG + Intergenic
1038843319 8:31206061-31206083 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1039048986 8:33475828-33475850 CTTTGAGAGGCCAATGTGGGTGG + Intronic
1039639006 8:39198619-39198641 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1039705351 8:40001070-40001092 CTTTGAAAGGCCAATGTGGGAGG - Intronic
1039708839 8:40035084-40035106 CTCTGGAGGGGAAATGTTGATGG + Intergenic
1039972750 8:42334301-42334323 TTCTGAAAGGGAAAATTGGAAGG + Intergenic
1040316604 8:46264227-46264249 CTCAGCAAGAGAAATGTGGTAGG + Intergenic
1041413575 8:57582669-57582691 CTCTGAAAGGCCAAAGCGGGTGG + Intergenic
1042635305 8:70867693-70867715 CTCTGGAAGGCCAAGGTGGGTGG - Intergenic
1043782954 8:84360114-84360136 CTTTGGAAGGCCAATGTGGGCGG - Intronic
1043805884 8:84671444-84671466 CTCTGACAGGGCAGTGTGGAAGG - Intronic
1044103295 8:88168949-88168971 CCTTGAAAGGCAAAGGTGGGAGG - Intronic
1044962585 8:97545379-97545401 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1045308173 8:100977094-100977116 CTTTAAGAGGGAAAGGTGGGTGG + Intergenic
1045610740 8:103838187-103838209 CTCTGGAAGGCAGAGGTGGGTGG - Intronic
1046400739 8:113700595-113700617 CTCTGAGAGGCCAAGGTGGGCGG - Intergenic
1046880185 8:119299107-119299129 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1047110472 8:121784073-121784095 CTCGGAAAGGCCAAGGTGGGTGG + Intergenic
1047416971 8:124672560-124672582 CTCTGAGAGGCCAAGGTGGGAGG + Intronic
1047924527 8:129669747-129669769 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1047933320 8:129751606-129751628 ATCTGAAAAGCAAATTTGGGGGG - Intronic
1048447344 8:134501663-134501685 CTTTGAAGGGGAAAGGTGAGTGG + Intronic
1048704035 8:137129949-137129971 CTCCGAAAGGGTAATGTGTATGG + Intergenic
1048768285 8:137867860-137867882 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1048798132 8:138170702-138170724 TGCTGAAAGGGAAATGTAGGTGG + Intronic
1049120374 8:140731649-140731671 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1049235704 8:141511215-141511237 CTGTGAAAGGGAAATTTGCAGGG - Intergenic
1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG + Intergenic
1050341296 9:4642009-4642031 CTTTGAGAGGCAAAGGTGGGTGG - Intronic
1050428294 9:5535036-5535058 CTCTGAAAGTCAAAGGTGAGTGG + Exonic
1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
1051642537 9:19237260-19237282 CTCTGGAAGGCCAAGGTGGGCGG - Intronic
1051966057 9:22831536-22831558 CTTGGAAGGGGATATGTGGGAGG + Intergenic
1052029691 9:23614356-23614378 CTTTGAAAGGCCAAGGTGGGGGG + Intergenic
1052279322 9:26715345-26715367 CTCAGAGAGGGAGATGTGGCAGG + Intergenic
1052749598 9:32476250-32476272 CTTTGAGAGGGCAAGGTGGGAGG + Intronic
1053246604 9:36539599-36539621 CTCTGAGAGGCCAAGGTGGGCGG + Intergenic
1053365206 9:37517969-37517991 CTCAGCCTGGGAAATGTGGGTGG - Intronic
1053496180 9:38549814-38549836 CTCTACTAGGGAAATGTGGAAGG + Intronic
1055175560 9:73313852-73313874 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1055225476 9:73989862-73989884 CTCTGCTAGGGAAGTGTGGAAGG - Intergenic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055438386 9:76315195-76315217 CTCTGAAAGGCCAGGGTGGGTGG - Intronic
1055453714 9:76454135-76454157 CTCTGAGAGGCCAAGGTGGGAGG + Intronic
1055921491 9:81465921-81465943 TTCCGAAAGAGAAATATGGGTGG - Intergenic
1055975972 9:81955582-81955604 CTCTGCTAGGGAAATGTGGAAGG - Intergenic
1056806260 9:89731383-89731405 AAATGAAAGGAAAATGTGGGTGG - Intergenic
1056844632 9:90026523-90026545 TTTTAAAAGGGAAATGTGGGTGG + Intergenic
1057103407 9:92387127-92387149 CTTTGAGAGGTCAATGTGGGTGG + Intronic
1057637221 9:96780423-96780445 CTTTGAGAGGCAAAGGTGGGTGG - Intergenic
1057804429 9:98210364-98210386 CTCTGACAGGCACATCTGGGAGG + Intronic
1057826772 9:98377762-98377784 CTCTGGAAGGGAGTTGGGGGTGG + Intronic
1058141188 9:101358136-101358158 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1058585749 9:106504594-106504616 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1058649224 9:107159455-107159477 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1058696365 9:107562535-107562557 CTCTGAAAGGCTGAGGTGGGAGG - Intergenic
1062258398 9:135642926-135642948 CTTTGAGAGGCAAAGGTGGGTGG + Intergenic
1062348558 9:136127367-136127389 CTCTGAAAGGGTGATGTGGAAGG - Intergenic
1185813417 X:3131522-3131544 CTTTGAGAGGCCAATGTGGGAGG - Intergenic
1185947840 X:4397742-4397764 CTTTTAAAGGGAGTTGTGGGTGG - Intergenic
1186172104 X:6888396-6888418 CTCTGGAAGGCCAAGGTGGGTGG + Intergenic
1187491684 X:19758080-19758102 CTCTGAGAGGCCAAGGTGGGCGG + Intronic
1187649956 X:21391282-21391304 CTCTACTAGGGCAATGTGGGGGG - Intronic
1188052963 X:25509384-25509406 CTCTGCTAGGGCAGTGTGGGGGG - Intergenic
1188071954 X:25727887-25727909 CTTTGAGAGGCCAATGTGGGCGG + Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1189307713 X:39999525-39999547 CTTTGAAAGGTTAAGGTGGGAGG + Intergenic
1189924161 X:45935473-45935495 CTCTGAAAGGCAAATGTTAGTGG + Intergenic
1190019327 X:46858714-46858736 CTCTGAGAGGCCAAGGTGGGAGG - Intronic
1190040284 X:47065700-47065722 CTTTGAGAGGCCAATGTGGGTGG + Intergenic
1190240128 X:48651612-48651634 CTCTGAGAGGCAGAGGTGGGTGG + Intergenic
1190293073 X:49005884-49005906 CTTTGGAAGGCAGATGTGGGTGG - Intergenic
1190809676 X:53871096-53871118 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1191018443 X:55835411-55835433 CTCAGCAAGGGGAATGTGGCAGG + Intergenic
1191047070 X:56149828-56149850 CTCTAAAGGGGAAAATTGGGAGG - Intergenic
1191671767 X:63754895-63754917 CTTTCAAAGGGAAAGGCGGGGGG + Exonic
1191866563 X:65708534-65708556 CTTTGAGAGGCCAATGTGGGCGG - Intronic
1192375848 X:70560990-70561012 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1192415976 X:70981151-70981173 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1193102776 X:77634983-77635005 CTCTAAAAGAGAAACGTGGCCGG + Intronic
1193291296 X:79776504-79776526 CTTTGAAAGGGCTAAGTGGGCGG - Intergenic
1193350374 X:80456863-80456885 ATGTGCAAGGGAAATGTGTGTGG - Intergenic
1194321143 X:92447640-92447662 CTCTGCTAGGGCAATGTGGAAGG + Intronic
1194473985 X:94335736-94335758 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1194484522 X:94471349-94471371 CTCTGCTAGGGAAGTGTGGAAGG + Intergenic
1195402426 X:104475688-104475710 GTCTGAATGGGGAGTGTGGGTGG - Intergenic
1195631196 X:107057110-107057132 CTCTGAGAGGCCAAGGTGGGAGG - Intergenic
1196157705 X:112449155-112449177 CTCTGACAGGGATATGGGGATGG + Intergenic
1196845980 X:119897051-119897073 CTTTGGAAGGCCAATGTGGGAGG - Intronic
1196979835 X:121200049-121200071 CTCAGAAGGGGAAATGTAGGAGG - Intergenic
1197513562 X:127398658-127398680 CTTTGATAAGGAAAAGTGGGTGG - Intergenic
1197683897 X:129417543-129417565 CTCTGAAGTGGAAAGGAGGGAGG + Intergenic
1198374339 X:136023052-136023074 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1199060544 X:143350817-143350839 CTCTGCTAGGAAAATGTGGAAGG - Intergenic
1199462669 X:148101369-148101391 CTCTGCTAGGGCAGTGTGGGAGG + Intergenic
1199599223 X:149531875-149531897 CTTTGAAAGAGAAGGGTGGGTGG - Intronic
1199764465 X:150930835-150930857 CTCTAAAAAGGAACTGTGGCTGG - Intergenic
1199875441 X:151924315-151924337 CTCTGAGGAGGAAATCTGGGAGG + Exonic
1200245761 X:154524104-154524126 CTTTGAAAGGCCAATGAGGGCGG + Intergenic
1200257185 X:154589428-154589450 CTCAGTAAGGGGAATGTGGCAGG - Intergenic
1200260585 X:154614974-154614996 CTCAGTAAGGGGAATGTGGCAGG + Intergenic
1200380739 X:155834712-155834734 CTCTGTTAGGGCAGTGTGGGAGG + Intergenic
1201012699 Y:9564065-9564087 CTCTGGGAGGGAAAGGTTGGAGG + Intergenic
1201268181 Y:12229014-12229036 CTTTGAGAGGCCAATGTGGGAGG + Intergenic
1201684925 Y:16690446-16690468 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1201772887 Y:17634569-17634591 CTTTGAAAGGCCAGTGTGGGTGG - Intergenic
1201828668 Y:18271417-18271439 CTTTGAAAGGCCAGTGTGGGTGG + Intergenic
1202193904 Y:22275709-22275731 CTTTGAGAGGCCAATGTGGGCGG + Intergenic