ID: 962922421

View in Genome Browser
Species Human (GRCh38)
Location 3:139963088-139963110
Sequence GAGAATGAGGAGGAGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6309
Summary {0: 1, 1: 14, 2: 195, 3: 1191, 4: 4908}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962922412_962922421 -9 Left 962922412 3:139963074-139963096 CCCTCATAAAAGATGAGAATGAG 0: 1
1: 0
2: 0
3: 34
4: 310
Right 962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG 0: 1
1: 14
2: 195
3: 1191
4: 4908
962922411_962922421 -8 Left 962922411 3:139963073-139963095 CCCCTCATAAAAGATGAGAATGA 0: 1
1: 0
2: 0
3: 21
4: 376
Right 962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG 0: 1
1: 14
2: 195
3: 1191
4: 4908
962922413_962922421 -10 Left 962922413 3:139963075-139963097 CCTCATAAAAGATGAGAATGAGG 0: 1
1: 0
2: 10
3: 26
4: 282
Right 962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG 0: 1
1: 14
2: 195
3: 1191
4: 4908

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962922421 Original CRISPR GAGAATGAGGAGGAGGAGGG GGG Intronic
Too many off-targets to display for this crispr