ID: 962925028

View in Genome Browser
Species Human (GRCh38)
Location 3:139985028-139985050
Sequence CAGTGGAGATGGAGAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1254
Summary {0: 1, 1: 7, 2: 42, 3: 158, 4: 1046}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962925028_962925033 12 Left 962925028 3:139985028-139985050 CCCATTTCTCTCCATCTCCACTG 0: 1
1: 7
2: 42
3: 158
4: 1046
Right 962925033 3:139985063-139985085 GCACACCATTGCTGCCTGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962925028 Original CRISPR CAGTGGAGATGGAGAGAAAT GGG (reversed) Intronic
900015739 1:147921-147943 CAGTGAAGATGTGGAGGAATTGG + Intergenic
900046002 1:506519-506541 CAGTGAAGATGTGGAGGAATTGG + Intergenic
900068204 1:748230-748252 CAGTGAAGATGTGGAGGAATTGG + Intergenic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900512042 1:3065379-3065401 CAGAGGAGTGGGAGAGAAAGGGG + Intergenic
900555639 1:3279050-3279072 AAGTTGACATGGAGAGAAACTGG - Intronic
900701245 1:4049811-4049833 GAGAAGAGAGGGAGAGAAATAGG + Intergenic
900701284 1:4049974-4049996 GAGAAGAGAGGGAGAGAAATAGG + Intergenic
901712969 1:11130168-11130190 AAGTGGAAGTGGAGAGAAAAAGG + Intronic
902098514 1:13966134-13966156 CAGAGGAAGGGGAGAGAAATAGG - Intergenic
902278459 1:15356972-15356994 CAGGGGAGAAGAAAAGAAATCGG - Intronic
902736339 1:18403775-18403797 GTGTGGAGATGGACAGACATAGG - Intergenic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903488341 1:23708189-23708211 CATTGGAGGTGGTGAGACATGGG + Intergenic
903561118 1:24228626-24228648 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
903662970 1:24989941-24989963 CACTGGAGGTGGGGAGAAATGGG + Intergenic
903930408 1:26858846-26858868 CAGTGGAGGTAGAGAGCAAATGG + Intergenic
904026213 1:27505132-27505154 CTGGGGAGTTGGAGAGAACTAGG + Intergenic
904202486 1:28830097-28830119 CTGAGGAGAGGGAGAGAGATGGG + Intronic
904727551 1:32561139-32561161 CAAAAGAGATGGTGAGAAATGGG - Intronic
904842821 1:33384525-33384547 CAATGAAGCTGGAGAGAAACAGG - Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905689844 1:39934944-39934966 GAGTGGAGATGGAAAGAATGAGG + Intergenic
905972124 1:42150180-42150202 CAGTGGAGATGATGAGAAACGGG + Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906713222 1:47948184-47948206 CAGTGGGGATAGAGAGACTTGGG + Intronic
906856576 1:49312832-49312854 CAGTGAAGATGCGGAGCAATAGG + Intronic
907093684 1:51754067-51754089 CAGTGGAGCTGGGGAGTAAGGGG + Intronic
907178402 1:52547385-52547407 TAGTGAGGATGTAGAGAAATTGG + Intronic
907191843 1:52655930-52655952 CCTTGAGGATGGAGAGAAATGGG + Intronic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
907931411 1:59004425-59004447 TAATGAAGATGTAGAGAAATTGG + Intergenic
908037068 1:60067297-60067319 TGGTGAAGATGTAGAGAAATAGG - Intronic
908098166 1:60762448-60762470 CAGTGCAGTGGGAGAGGAATGGG + Intergenic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
908982621 1:69977048-69977070 CAATGGAGATGCAGAGTATTGGG - Intronic
909085416 1:71165104-71165126 GAGTGGAGAAAGAGAGAAACAGG - Intergenic
909132490 1:71755260-71755282 CAGTGGAGGTGAAGAGGACTCGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909845663 1:80390725-80390747 AAGGGGAGATAGAGAGAAGTTGG + Intergenic
909914235 1:81298052-81298074 CAGAGAAGATGGAGAGGACTGGG + Intergenic
910151536 1:84153092-84153114 CCAAGGAGAGGGAGAGAAATGGG + Intronic
910520083 1:88110891-88110913 CAGTGGAAATGGACAGGAAGTGG - Intergenic
911294212 1:96094124-96094146 CAGTGGAAAGGGAGAGGTATTGG + Intergenic
911591413 1:99752437-99752459 CTGAGGAGAAGGAGAGAGATTGG + Intronic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912346154 1:108965137-108965159 CAGTGGAGATGTGGGGAAATTGG - Intergenic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912580796 1:110719243-110719265 GAATGGAGATGAAGAGAACTGGG + Intergenic
912718174 1:111997133-111997155 AGGAGGAAATGGAGAGAAATGGG - Intergenic
912827120 1:112915686-112915708 TAGTTGTGATGGAGAAAAATGGG + Intronic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913174090 1:116257942-116257964 CAGTGAGGATGTGGAGAAATTGG + Intergenic
913270745 1:117090764-117090786 GAGGGGAGAAGGAGAAAAATGGG - Intronic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913313680 1:117531496-117531518 TAGTGGAGATGTGGAGAAACTGG - Intergenic
914356759 1:146892283-146892305 CTGTGGAGAAGCAGAAAAATGGG + Intergenic
914776291 1:150738829-150738851 CAGAGGAGAGAGAGAGAGATGGG - Intronic
915141143 1:153769377-153769399 AAGTGGAGAGGAGGAGAAATGGG - Intronic
915144815 1:153790222-153790244 CAATGGAGATGGACAGAGAAGGG + Intergenic
915369595 1:155337481-155337503 TAGTGGAGAGGGAGAGGAAAGGG - Exonic
915402035 1:155629366-155629388 CATTGGAGATGCAAAGAAAAGGG - Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915688050 1:157656167-157656189 CAGCAGAAAAGGAGAGAAATTGG + Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
916191587 1:162184159-162184181 CTGAGGAGAGGGAGAGAGATGGG + Intronic
916536973 1:165712554-165712576 GAGCTGAGAGGGAGAGAAATGGG - Intergenic
916635822 1:166667487-166667509 CAGAGAGGATGTAGAGAAATAGG + Intergenic
916678558 1:167084304-167084326 CAGAGGAAATGGAGAAAAACGGG + Intronic
916800204 1:168208718-168208740 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
916808808 1:168286861-168286883 TGGTGAAGATGTAGAGAAATTGG - Intronic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
917512938 1:175683094-175683116 AAGTGGACAGGGAGAGAAAAGGG - Intronic
917866373 1:179199506-179199528 CTGTGAAGATGTAGAGAGATTGG - Intronic
917873667 1:179265662-179265684 TGGTGAAGATGTAGAGAAATTGG - Intergenic
918127346 1:181596108-181596130 CCGGGGAGATTGAGAGAAAGAGG + Intronic
918152056 1:181806086-181806108 CCTGGGAGATGGAGAGAAAGAGG + Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918352326 1:183670134-183670156 GTGGGGAGATGGAGAGAGATAGG - Intronic
918691290 1:187483359-187483381 CAGTGGAGATGGAGGGGTTTGGG - Intergenic
919436051 1:197562634-197562656 CTGAGGAGAGGGAGAGAGATGGG - Intronic
919598887 1:199599001-199599023 CAGGGGAGACGAAGAGAAATTGG + Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
919855260 1:201701738-201701760 CAGTGAAGATATGGAGAAATTGG + Intronic
919856405 1:201709247-201709269 CACAGGAGATGGTGAGAAAGGGG + Intronic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920616144 1:207494774-207494796 AATGGGAGATGGAGAGAGATTGG + Intergenic
920632717 1:207668526-207668548 AATGGGAGATGGAGAGAGATTGG + Intronic
921226425 1:213024595-213024617 CTTGGGAGATGGAGAGAAAAGGG - Intergenic
921363050 1:214347892-214347914 CAATGAAAATGGAGATAAATCGG - Intergenic
921402625 1:214743043-214743065 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
922103568 1:222493617-222493639 CAGTGAAGATGTGGAGGAATTGG + Intergenic
922263882 1:223966132-223966154 CAGTGAAGATGTGGAGGAATTGG + Intergenic
922659155 1:227414082-227414104 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
922852223 1:228742755-228742777 CAGTGCAGATGGGATGAAATTGG + Intronic
923071587 1:230570111-230570133 GTGAGGATATGGAGAGAAATTGG - Intergenic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923294116 1:232576482-232576504 CTGAGGAGAGAGAGAGAAATGGG - Intergenic
923374642 1:233348630-233348652 CAAGGAAGATGGAGAGAAATCGG - Intronic
923850620 1:237790335-237790357 CTGTGGAGATGGCAAGAACTGGG - Intronic
924144488 1:241060017-241060039 CTGTGGAGTGGGAGAGAAATGGG - Intronic
924345729 1:243071128-243071150 CAGTGAAGATGTGGAGGAATTGG + Intergenic
924484744 1:244470521-244470543 TCGTGGGGATGTAGAGAAATGGG + Intronic
1062955437 10:1537320-1537342 CAGTGAGGATGTGGAGAAATTGG + Intronic
1063281634 10:4635866-4635888 CACTGGAGATGCTGAGAATTTGG - Intergenic
1063312992 10:4972919-4972941 CAACAGAGGTGGAGAGAAATAGG + Intronic
1063555030 10:7070211-7070233 TATTGGATATGGAGAGAAAGAGG + Intergenic
1064291956 10:14043430-14043452 CAGTGGGCAGGGAGTGAAATTGG - Intronic
1064484911 10:15776359-15776381 TGGTGAAGATGGGGAGAAATTGG - Intergenic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1065030653 10:21582655-21582677 TAGTGGAGATGGAGAGAGAGAGG + Intronic
1065111589 10:22445221-22445243 AACTGGAGAAGGAGAGAAATGGG + Intronic
1065645294 10:27827630-27827652 CCCTGGAGATGAAGAGAAATGGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065886825 10:30085671-30085693 CAGTGGAGATGGGGAGTGATAGG + Intronic
1066331188 10:34425114-34425136 CAGTAGAGATGGAAAAAAATTGG - Intronic
1066520679 10:36214894-36214916 AAATGGAGATGGTAAGAAATAGG + Intergenic
1066730611 10:38433687-38433709 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1067271088 10:44791765-44791787 GAGTGAATATTGAGAGAAATAGG - Intergenic
1067314333 10:45147625-45147647 CAGTGAAGATGCAGATAAAGTGG + Intergenic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068090534 10:52427645-52427667 CAGTGGAGAGGGAGATATATGGG - Intergenic
1068119568 10:52772026-52772048 AAGAGGACATGGAGAGAAAGAGG - Intergenic
1068379607 10:56234037-56234059 TAGTGGAAATGGAGATAACTGGG - Intergenic
1068714866 10:60177005-60177027 CAGTGGAGATGGTGAAATGTAGG - Intronic
1068961754 10:62873399-62873421 TAGTGAAGATGCAGAGAAACTGG - Intronic
1069166931 10:65171894-65171916 TAGTGGAGATGGAGAAGAATAGG + Intergenic
1069222256 10:65898948-65898970 CAGTGGAAAAGGTCAGAAATTGG + Intergenic
1069625463 10:69865186-69865208 CAGTACAGATGGAGAGAGAGAGG - Intronic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070236723 10:74635294-74635316 CAGTGGAGATCAAAAGAAAGTGG + Intronic
1070429685 10:76324783-76324805 TATTAGTGATGGAGAGAAATTGG + Intronic
1070459796 10:76653229-76653251 CAGTGATGATGTGGAGAAATTGG - Intergenic
1070495293 10:77015836-77015858 GAGTGGAGGTGGAGAGAGGTGGG - Intronic
1070541805 10:77420817-77420839 AAGCTGAGATGGAGAGAAGTGGG - Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071514972 10:86291281-86291303 CAGTGGGGATGGAGGTCAATGGG - Intronic
1071818464 10:89255580-89255602 CAGTGAAAGTGGAGAAAAATAGG + Intronic
1071849044 10:89550081-89550103 CAGTGCAGATGGAAAAAAAGGGG - Intronic
1071851653 10:89577742-89577764 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1072797190 10:98365102-98365124 CACTGGGGATGAAGAGAAAAAGG + Intergenic
1073170580 10:101504525-101504547 CAGTGGGGTTGGTGAGAGATGGG - Intronic
1073325710 10:102643244-102643266 GAGCAGAGGTGGAGAGAAATCGG + Intergenic
1073598990 10:104828361-104828383 CTGAGGAGAAGGAGAGAGATGGG + Intronic
1073772292 10:106748479-106748501 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1073823747 10:107295711-107295733 CAGTGAACATGTAGAGAAAAAGG + Intergenic
1074396916 10:113105558-113105580 GAGTGAAAAAGGAGAGAAATGGG - Intronic
1074497791 10:113995126-113995148 CATGGGTTATGGAGAGAAATAGG + Intergenic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1075159585 10:120011574-120011596 AAGTGAAGAGGGAGAGAATTCGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1075993651 10:126859368-126859390 TAGTGGAGATGAAGAGGAAGAGG - Intergenic
1076199227 10:128545175-128545197 GAGTAGAGGTGGAGAGACATGGG - Intergenic
1076205922 10:128602760-128602782 CTGAGGAGAGGGAGAGAATTGGG - Intergenic
1076262294 10:129076424-129076446 CACAGGAGATGGAGAGAGATAGG - Intergenic
1076947802 10:133664402-133664424 GAGGGGAGATGGGGAGACATTGG + Intergenic
1076954707 10:133740581-133740603 GAGGGGAGATGGGGAGACATTGG + Intergenic
1076972330 11:142991-143013 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077263758 11:1638506-1638528 CCCTGGAGAGGGAGAGAGATAGG - Intergenic
1077347306 11:2068835-2068857 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077826536 11:5815584-5815606 CAGTGAGAATGTAGAGAAATTGG + Intronic
1078259489 11:9691367-9691389 CAGTGAGGATGCAGAGACATTGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078442594 11:11379675-11379697 CGATGGAGATGGAGACCAATAGG - Intronic
1078496314 11:11820732-11820754 CAGTGGAGATGGAAAAACCTGGG + Intergenic
1078822260 11:14894007-14894029 CGTGGGAGATGGAGAGAAATTGG - Intergenic
1078847902 11:15138068-15138090 CAGAGGAGAGGGAGAAAGATAGG + Intronic
1079161831 11:18002223-18002245 CAGTTGGGATGGAGAGTAAGAGG - Intronic
1079303680 11:19303420-19303442 CTGAGGAGACGGAGAGAGATGGG + Intergenic
1079869145 11:25774280-25774302 CGGTGAGGATGTAGAGAAATTGG - Intergenic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080236437 11:30074159-30074181 GAGAGGAGATGGGGAGATATAGG - Intergenic
1080360499 11:31507667-31507689 CAGGGGGGATGGGGAGAATTTGG + Intronic
1080826329 11:35852196-35852218 CAGCAGAGAAGGAGTGAAATGGG - Intergenic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081953120 11:47063479-47063501 GACTGGAGGAGGAGAGAAATGGG - Intronic
1082263100 11:50092397-50092419 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1082568339 11:54708114-54708136 CAATGGAGAAAGAGAGGAATAGG + Intergenic
1082653847 11:55828016-55828038 CAGTGGAGATGTTGACAAAGTGG + Exonic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1084101598 11:66953234-66953256 CTGCGGAGATGCAGAGAAAGCGG - Intronic
1084116740 11:67046763-67046785 AAGTGGAGGAGGAGAGAGATCGG + Intronic
1084770902 11:71342283-71342305 CAGTGGAGAACGTGAGAAGTGGG + Intergenic
1084904750 11:72336936-72336958 CACTGGAGGAGGAGAGAACTGGG - Intronic
1084951333 11:72667501-72667523 CAATGGAGGTGGAGAACAATGGG + Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085534460 11:77209674-77209696 AGGTGGTGATGGAGAGACATGGG - Intronic
1085731372 11:79001969-79001991 CAGGGGAGATGGGGAGCTATGGG - Intronic
1085754943 11:79194510-79194532 CAGTGGAGATGAGGAAATATTGG + Intronic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086318608 11:85620299-85620321 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1086896968 11:92324454-92324476 CCGAGGAGAGGGAGAGAGATGGG + Intergenic
1087913954 11:103786394-103786416 CAGAGGAGAGGGAGAGAGATGGG + Intergenic
1088218948 11:107546531-107546553 TATTTGAGATGGAAAGAAATTGG + Intronic
1088523906 11:110730638-110730660 AACTGCAGCTGGAGAGAAATAGG + Intergenic
1088567875 11:111192130-111192152 CAGAGGAGAGGGAGAGACATGGG - Intergenic
1088596513 11:111445036-111445058 CAGTGGCGAAGAAGAGAGATGGG + Intronic
1088979057 11:114844931-114844953 CAGTGAAGAGGGAGCAAAATAGG + Intergenic
1089061857 11:115632256-115632278 CCTTGGAGAAGGAGAGGAATGGG + Intergenic
1089845548 11:121455284-121455306 CATGGGAGATGGAGAGATAAGGG + Intronic
1090147786 11:124345098-124345120 CTGAGGAGAGGGAGAAAAATGGG - Intergenic
1090572398 11:128061546-128061568 CACTGGAGGTGGGGAGAAAGAGG + Intergenic
1090855161 11:130604597-130604619 GAGTGGAGAGGGAGGGACATGGG + Intergenic
1091297783 11:134486079-134486101 GAGTGGAGAAGGGGAGAAAGGGG + Intergenic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091675657 12:2487283-2487305 CAGTGTCGATGGAGAAAATTAGG - Intronic
1092152350 12:6259181-6259203 CAGAGGAGAGGAAGAGAGATAGG + Intergenic
1092229871 12:6770369-6770391 CTGTGGAGAGGGAGAGAATGGGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1092927144 12:13281624-13281646 CAGTGATCATGGTGAGAAATGGG - Intergenic
1094280111 12:28727559-28727581 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
1094280686 12:28734271-28734293 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1094361349 12:29634558-29634580 CAGTAGTGATGGAGTGAAATCGG + Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1095302784 12:40606145-40606167 CAGTGAAAATGTAGAGAAACTGG + Intergenic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095790948 12:46166390-46166412 CAATGGAAAGGAAGAGAAATGGG + Intergenic
1096039166 12:48499542-48499564 GAGTGGAAGTGGTGAGAAATGGG - Intergenic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096259041 12:50079652-50079674 CGATGTAGATGGAGAGAACTAGG - Intronic
1096398594 12:51286757-51286779 CTGTGCTGATGGAGAGAGATAGG - Intronic
1096427965 12:51520346-51520368 CAATGGTGATGGAGAGGAAGAGG + Intergenic
1096440326 12:51637204-51637226 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096747894 12:53740127-53740149 CAGTGGAGGTGGAGGGAGAGCGG - Intergenic
1097573816 12:61365586-61365608 CAGTGGAGCAGGAGTGGAATGGG - Intergenic
1097623168 12:61966139-61966161 CAGTGAAGATGAGGAGAAGTTGG - Intronic
1097652842 12:62323094-62323116 CAATGGACATTGAGAGAAATAGG - Intronic
1097788607 12:63789256-63789278 CCAAGGAGATGGGGAGAAATGGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098466955 12:70798268-70798290 CAGTGGAGACAGATAAAAATGGG - Intronic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099080200 12:78169153-78169175 CAGTGGAGATGGAGATGGAGTGG + Intronic
1099168676 12:79338189-79338211 CAATGGAAATGGTGAAAAATGGG - Intronic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099461369 12:82925762-82925784 CCATGGAAAGGGAGAGAAATTGG - Intronic
1099801710 12:87465349-87465371 CAGTGAAGATGTGGAAAAATAGG - Intergenic
1099861131 12:88227442-88227464 CACTGGAGATCGAGAGAGAGAGG + Intergenic
1100088324 12:90938366-90938388 AAGTGGAGTTGAAGAGCAATGGG + Intronic
1100272202 12:93037230-93037252 TAGTGAGGATGTAGAGAAATTGG - Intergenic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100312782 12:93413043-93413065 CAGAAGAGGAGGAGAGAAATTGG - Intronic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1100497405 12:95138633-95138655 CAGTGTGGTGGGAGAGAAATGGG - Intronic
1100631276 12:96391737-96391759 TAGTGAAAATGGAGAGAAAAGGG - Intronic
1100927299 12:99563456-99563478 CTGAGGAGAGGAAGAGAAATAGG + Intronic
1101006620 12:100406959-100406981 CAATGGAGATGGAGAGAGGGGGG + Intronic
1101010208 12:100441566-100441588 GAGTGGAAGTGGTGAGAAATGGG + Intergenic
1101108323 12:101461304-101461326 CAGAAGAGATGGAAACAAATAGG + Intergenic
1101143179 12:101817056-101817078 CAGTGGGGATGAAGAGTGATTGG + Intronic
1101327790 12:103731874-103731896 CTGGGGAGAGGGAAAGAAATTGG + Intronic
1101444634 12:104728838-104728860 GTGTGGAGATGGACAGAAAGGGG + Intronic
1101580659 12:106038585-106038607 CCGTGGAGTTAGAGAGAACTGGG + Intergenic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1101730443 12:107422601-107422623 CAGTGGAGGTGATGAGAAGTTGG + Intronic
1102116427 12:110406579-110406601 CAGATGAGAAGGAGAAAAATTGG + Intergenic
1102570561 12:113824792-113824814 CCGTGGAGATGATGAGAAACGGG - Intronic
1102688571 12:114742811-114742833 CAGCAGAGATAGAGTGAAATGGG + Intergenic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103250595 12:119496637-119496659 CCGTGAAGATGAAAAGAAATGGG - Intronic
1103911749 12:124355829-124355851 CAGTGGAAATGGGGAGACAGGGG - Intronic
1103948822 12:124540938-124540960 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103948899 12:124541173-124541195 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103948913 12:124541218-124541240 AGGTGGAGATGGAGGGAGATGGG + Intronic
1103949013 12:124541519-124541541 GAGTGGAGATGGAGAGGGAAGGG + Intronic
1103949091 12:124541748-124541770 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103949120 12:124541815-124541837 GAGTGGAGATGGAGGGGGATGGG + Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104501740 12:129292957-129292979 CAGTGGAGAAGTAGAGATATTGG + Intronic
1104577383 12:129980263-129980285 CAGTGAAGATGGAAAGAATTGGG + Intergenic
1104635277 12:130434653-130434675 CCGTGGAGATCAAGAGACATGGG - Intronic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1104746286 12:131212813-131212835 CAGTGAAGATGTGGAGAAACTGG + Intergenic
1104805445 12:131586581-131586603 CAGTGGAGCTGGGGAGAAACGGG + Intergenic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105211056 13:18257293-18257315 GGGTGGAGATGGAGAGAGTTAGG + Intergenic
1105279897 13:18957431-18957453 CAGTGGACAGTGAGAGAGATGGG - Intergenic
1105580481 13:21691368-21691390 CAGAGGAGATGGAGAAAAACAGG + Intronic
1105619848 13:22056172-22056194 CCATGGGGGTGGAGAGAAATGGG + Intergenic
1105774713 13:23646920-23646942 TGGTGGAGATGTGGAGAAATTGG - Intronic
1106155536 13:27152011-27152033 CAATGGGGATGCAGAGAAATGGG + Intronic
1106769222 13:32945418-32945440 CCTTGGAGATGGGGAGAAATGGG + Intergenic
1106796648 13:33213298-33213320 AAAAGGAGAGGGAGAGAAATGGG + Intronic
1107131507 13:36901308-36901330 CAGTGAGGATGTAGAGAAATTGG - Intronic
1107404985 13:40103784-40103806 CATTGGAGCTGGAGAGATCTTGG - Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108148148 13:47501327-47501349 CAGTGGCAGTGGGGAGAAATGGG - Intergenic
1108411439 13:50151655-50151677 TAGTGAGGATGGGGAGAAATTGG - Intronic
1108474012 13:50795484-50795506 CAGTGGAGATGATGTGAAAAAGG + Intronic
1108543382 13:51465883-51465905 CAGTAAAGGTGGTGAGAAATGGG + Intergenic
1108998721 13:56767771-56767793 CAGAGAGGATGTAGAGAAATAGG - Intergenic
1109515478 13:63438348-63438370 CTGAGGAGAAGGAGAGAGATAGG + Intergenic
1109889617 13:68591633-68591655 TAGTAGGGATGCAGAGAAATAGG - Intergenic
1110252968 13:73401517-73401539 CAAAGGGGATGGAGTGAAATGGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110398427 13:75060738-75060760 TAGTGAAGATGCAGAGAAAAGGG + Intergenic
1110505482 13:76280940-76280962 CTGTGGAAATGAAGAGAAAGAGG - Intergenic
1110661498 13:78063267-78063289 CCATGGAGATAAAGAGAAATAGG - Intergenic
1111128922 13:83949107-83949129 CAGTGTAGATGCAGAGACAGAGG + Intergenic
1111247737 13:85562946-85562968 AGTTGGGGATGGAGAGAAATGGG + Intergenic
1111292961 13:86191134-86191156 CAGTGGAGGTTGGGGGAAATGGG + Intergenic
1111640517 13:90963853-90963875 CCGAGGAGAAGGAGAGAGATGGG - Intergenic
1111937108 13:94568952-94568974 CAATGAGGATGTAGAGAAATTGG - Intergenic
1111956190 13:94761215-94761237 CAAAGGAGATGGGGAGAAAGGGG - Intergenic
1112461100 13:99604543-99604565 GAGTGGGGCTGGAGATAAATTGG + Intergenic
1112521151 13:100096422-100096444 CTGAGGAGAGGGAGAGACATAGG - Intronic
1112834700 13:103500109-103500131 CAAAAGAAATGGAGAGAAATGGG + Intergenic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1114361019 14:21972801-21972823 CGGTGAGGATGTAGAGAAATAGG + Intergenic
1114409320 14:22485996-22486018 CAGAGGAAATGGAGAGAGATGGG + Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115141746 14:30179614-30179636 GAGGAGAGATGGAGAGAACTAGG + Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115757207 14:36540638-36540660 CAGTGAAGGTAGAGAGATATAGG + Intergenic
1115795887 14:36935275-36935297 AAGTTGAGATGGAAAGATATGGG - Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1117042096 14:51776752-51776774 CAGAGGAGAGAGAGAGAGATGGG + Intergenic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117207336 14:53457351-53457373 GAGGGGAGATGGATAAAAATAGG - Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1117972256 14:61263622-61263644 CAATGGATATGGATACAAATAGG - Intronic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118688385 14:68314237-68314259 CAGTGGAGTAGGAGTGAACTGGG - Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119885001 14:78132837-78132859 CAGGGGAGATGCAGAGATATTGG + Intergenic
1120029479 14:79624659-79624681 AAGAGGAGATGGGGAGATATAGG - Intronic
1120262590 14:82205653-82205675 CGGTGAAGATGGGGAGAAAAGGG - Intergenic
1120545769 14:85809406-85809428 AAGTGGAGATGTAGAGAGGTAGG + Intergenic
1121328984 14:93037734-93037756 CAGTGGAGATGGTGAGACTCAGG + Intronic
1121827191 14:97019919-97019941 ATGGGGAGATGGGGAGAAATTGG - Intergenic
1121859048 14:97299340-97299362 CAATGGGGATGGAGAGAGAAGGG - Intergenic
1122149606 14:99717830-99717852 AAGTGGAGGTGGAGAGGAATGGG - Intronic
1122170397 14:99869436-99869458 CAATGGAGAGGGAAAGAGATGGG - Intronic
1122662577 14:103307649-103307671 CTGAGGAGTTGGAGAGAGATGGG + Intergenic
1123067188 14:105624665-105624687 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123071207 14:105643392-105643414 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123076169 14:105668435-105668457 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123090867 14:105741662-105741684 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1124255398 15:28137670-28137692 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124427381 15:29572995-29573017 TAGTGGAGATGTCGAGAATTGGG + Intergenic
1124568912 15:30841952-30841974 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1124936207 15:34173748-34173770 GAGAGGAGATGGAGACAACTGGG + Intronic
1125012637 15:34897072-34897094 CAGAAGAGATTGAGAGAACTGGG - Intronic
1125315384 15:38425970-38425992 TAGGGGAGATGAAGAGAGATTGG + Intergenic
1125551102 15:40545505-40545527 CAGAGGAGGTGGAGAGAATGGGG + Intronic
1125841503 15:42805608-42805630 TAATAGAGATGGAGGGAAATGGG - Intronic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1126410456 15:48368132-48368154 CAGAGCAGATGTAGAGAAAGGGG - Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126669596 15:51104215-51104237 CCGTGGAGATGGAAAGGAAAGGG - Intronic
1126719481 15:51561978-51562000 AAAAGGAGATGAAGAGAAATTGG + Intronic
1127081432 15:55384179-55384201 CAAAGGAGAGGGAGAGAGATGGG + Intronic
1127244851 15:57161107-57161129 TAATTGAGATGGGGAGAAATGGG + Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1127970181 15:63952510-63952532 CAGTGGATGAGGACAGAAATAGG + Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128153041 15:65375414-65375436 AAGGGGAGATGGAAGGAAATAGG + Intronic
1128511874 15:68318514-68318536 CAGTGGAGAGGGAGTGGGATTGG + Intronic
1128637315 15:69311486-69311508 CAGGGGAGATGGAAACAACTTGG - Intronic
1128806914 15:70538078-70538100 AAGTGGACAAGGAGAGAAAGGGG - Intergenic
1129101101 15:73264943-73264965 CGGTGCTGAGGGAGAGAAATGGG + Intronic
1129576756 15:76757265-76757287 GAGGGGAGATGGAGTGATATTGG - Intronic
1129627951 15:77224877-77224899 CTGTGGAAATGGAAAGAGATGGG - Intronic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1130129831 15:81130837-81130859 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1130272652 15:82460081-82460103 CAGTGGTGCTGCAGATAAATTGG - Intergenic
1130465004 15:84187434-84187456 CAGTGGTGCTGCAGATAAATTGG - Intergenic
1130487684 15:84407370-84407392 CAGTGGTGCTGCAGATAAATTGG + Intergenic
1130499261 15:84486103-84486125 CAGTGGTGCTGCAGATAAATTGG + Intergenic
1130587294 15:85192048-85192070 CAGTGGTGCTGCAGATAAATTGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130955340 15:88623411-88623433 CAGCAGAGATTAAGAGAAATGGG - Intronic
1130990763 15:88874354-88874376 CAGTGGACCTGGAAAGAAAGTGG - Intronic
1131303817 15:91223766-91223788 TACTGGAGATGGTGAAAAATCGG + Intronic
1131352977 15:91718373-91718395 CAGGGGACATGGAGAAGAATGGG + Intergenic
1131838571 15:96414115-96414137 AATTGGAGCTGGAGAGAAAAGGG + Intergenic
1131878774 15:96839702-96839724 CAGTGAGGATGTGGAGAAATTGG + Intergenic
1131909948 15:97187307-97187329 CGGAGGAGATGAAGAGAGATGGG + Intergenic
1132175272 15:99709161-99709183 CAGTAGAGATGGTGAGACCTGGG + Intronic
1132202226 15:99962888-99962910 CAGTGAAGATAGGGAGAAGTGGG + Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1133729355 16:8566673-8566695 GAGGGTTGATGGAGAGAAATAGG - Intergenic
1133866532 16:9649135-9649157 CAGGAGGGATGAAGAGAAATTGG + Intergenic
1134201765 16:12205094-12205116 CAGTGAAGATGGAGAGTCGTGGG + Intronic
1134371110 16:13625760-13625782 TAGTGAAGATTTAGAGAAATAGG - Intergenic
1134775903 16:16853303-16853325 AAGTGAAGATGGATTGAAATAGG + Intergenic
1135141401 16:19925191-19925213 CAGTGAGGATGTTGAGAAATAGG - Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135244426 16:20842976-20842998 CAGTGAAGATGTAGATAAGTTGG - Intronic
1135481890 16:22827488-22827510 CAGTGGTGGTGGAGAGAGAAAGG + Intronic
1135511454 16:23088101-23088123 CAGTGAAGATGGAGAGCACAGGG + Intronic
1135557217 16:23447069-23447091 CAGTGAAGATGATGAGTAATGGG - Intronic
1135609019 16:23848595-23848617 CAGTGGAGAGGGAGAGGGAGTGG - Intronic
1135612874 16:23883659-23883681 CAGTGCAGAGGGAGAGACACAGG + Intronic
1135698601 16:24611679-24611701 CAGTGGAGATGGACAGGGAGAGG + Intergenic
1135722906 16:24832354-24832376 CAGTGGAGAAAGAGAGGGATGGG + Intergenic
1136173457 16:28502285-28502307 CAGTGGAGATGGAAGGAATGGGG - Intronic
1136237992 16:28926038-28926060 CGCTGGAGATGGAGAAAAAGGGG - Intronic
1136344392 16:29665514-29665536 AAATGGTGATGGAGATAAATAGG - Exonic
1137306581 16:47206777-47206799 TAGCAGTGATGGAGAGAAATGGG - Intronic
1137408855 16:48211053-48211075 CACTGGAGCTGGAGAGGAACGGG - Exonic
1137416166 16:48282703-48282725 CAGAGGAGAGGGAGAGAGAAAGG - Intronic
1137420045 16:48325393-48325415 TAGTGGGGATGGGGAGAGATTGG - Intronic
1137900929 16:52268183-52268205 CCGAGGAGAGGGAGAGAGATGGG - Intergenic
1138308672 16:56004339-56004361 AAGTGGTGATGGGAAGAAATGGG - Intergenic
1138540303 16:57683824-57683846 CAGTGGGGGTGGAGAGCCATAGG + Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1138835212 16:60426525-60426547 CATTGCAGAGGGCGAGAAATGGG - Intergenic
1138929374 16:61633660-61633682 CAGAGAAGATGGAGAGGAACTGG - Intergenic
1138981715 16:62277223-62277245 GAGTGGAGATGGGGAAGAATTGG - Intergenic
1139070824 16:63380404-63380426 CAATGAACATGAAGAGAAATTGG + Intergenic
1139278305 16:65748462-65748484 CAGTGAAGCTGGAGAGGAAAGGG - Intergenic
1139977255 16:70823170-70823192 CTGTGGAGAAGCAGAAAAATGGG - Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140390436 16:74582046-74582068 CAGTAGAGAGGGTGAGAGATTGG - Intronic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1141906045 16:87027808-87027830 GAGTGGAGAGAGAGAGAAAGAGG - Intergenic
1142447920 16:90154531-90154553 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1142459569 17:80792-80814 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1142470542 17:161101-161123 CTGGGGAGATGGGGAGAGATGGG - Intronic
1142496859 17:310556-310578 ATGTGGAGATGGAGATAAACAGG + Intronic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1143058404 17:4179819-4179841 CAATGGAGAAGGAGAGGAAGAGG - Exonic
1143083991 17:4402251-4402273 ATGTGAAGATGGAGAGAGATTGG + Intergenic
1143168455 17:4911353-4911375 AGGGGGAGATGGAGAGAAAGAGG + Intergenic
1143465348 17:7132765-7132787 CAGTGGAGACGGAGGGACAGTGG - Intergenic
1143479884 17:7222093-7222115 CGGAGGAGAAGGGGAGAAATGGG - Intronic
1144051617 17:11501857-11501879 TAGTGGAAAAGGAGAGAAAAGGG + Intronic
1144058734 17:11562775-11562797 CAGTGGAGGTGGGGAGGAACGGG - Exonic
1144220245 17:13093154-13093176 CAGTGGAGGTCGAGACAGATGGG + Intergenic
1144505279 17:15824149-15824171 CAGTGAAGATGTGGAGAAATCGG - Intergenic
1144620889 17:16817933-16817955 GAGTGGGGATGGGGAGAAAGTGG - Intergenic
1144645239 17:16969056-16969078 CGGTGAAGATGTGGAGAAATTGG + Intronic
1144967292 17:19085628-19085650 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1144980628 17:19166438-19166460 CCCTGGGGATGGAAAGAAATGGG - Intergenic
1144987594 17:19211795-19211817 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1145055885 17:19703839-19703861 GAGTGGGGATGGGGAGAAAGTGG + Intronic
1145169456 17:20642023-20642045 CGGTGAAGATGTGGAGAAATCGG - Intergenic
1145277729 17:21444528-21444550 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1145713997 17:27002345-27002367 CCGAGGAGAGGGAGAGAGATGGG + Intergenic
1145886217 17:28384241-28384263 CAGGGCAGATGGAGAGACTTTGG + Intronic
1146421582 17:32691317-32691339 TAGTGGAGATGAAGAGCGATTGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1146949314 17:36894697-36894719 CAGTGGTGATGGAGAGTGTTGGG - Intergenic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147117548 17:38312936-38312958 CAGTGAGGATGTAGAGAAACTGG - Intronic
1147450501 17:40501106-40501128 GAGTGAAGGTGGGGAGAAATGGG - Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1148339545 17:46865143-46865165 GAGTGGAGAGGGAGAGAGACAGG + Intronic
1148412139 17:47476654-47476676 CAGTGAGGATGTAGAGAAACTGG + Intergenic
1148466065 17:47866038-47866060 CAGGGGAGATGATGAAAAATTGG - Intergenic
1148535708 17:48436941-48436963 CAGTTAAGATGGACAGAAAGAGG - Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149003987 17:51785526-51785548 CAGTGAAGATGTAGAGAAAAGGG + Intronic
1149299412 17:55290593-55290615 CCAAGGAGAGGGAGAGAAATGGG - Intronic
1149317321 17:55450836-55450858 CAAAGGAGATGGAAAGAAGTGGG - Intergenic
1149354469 17:55825864-55825886 CAGTGAAAATGAGGAGAAATGGG - Intronic
1149635966 17:58169748-58169770 CAGTGGTGATGTAGACAAACAGG - Exonic
1149688253 17:58551433-58551455 CAATAGAAATGGAAAGAAATGGG + Intergenic
1149816394 17:59728942-59728964 CAGATGAGCTGGAGAAAAATGGG - Intronic
1150191634 17:63246946-63246968 CAAAGGAGATGTAGAGAAACAGG - Intronic
1150317740 17:64183735-64183757 TAGTGAGGATGTAGAGAAATTGG - Intronic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1150509350 17:65733182-65733204 CCAAGGAGATGGAGAGAGATGGG + Intronic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1151629489 17:75300869-75300891 CAGCGGGGATGGCGAGAAACTGG - Intergenic
1152262618 17:79275161-79275183 CAGGGGAGGGGGAGAGAGATAGG - Intronic
1152885209 17:82845438-82845460 CAGACGAGATGGAGAGGAAGGGG - Intronic
1153098343 18:1435428-1435450 CAGTGAAGTTGGAAAGAAGTAGG - Intergenic
1153133183 18:1881397-1881419 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1153175432 18:2366987-2367009 TAGAGGAGAGGGAGAGAGATGGG - Intergenic
1153292801 18:3518220-3518242 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1153390575 18:4553246-4553268 TGGTGAAGATGCAGAGAAATTGG - Intergenic
1153546338 18:6209502-6209524 CAGTGAAGATGTGGAGAAATTGG + Intronic
1153605722 18:6829295-6829317 CTGTGGAGCTGGACTGAAATTGG - Intronic
1153871729 18:9327342-9327364 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1154473184 18:14724633-14724655 CAGTGAAGATGCAGAGGAATTGG - Intergenic
1155080977 18:22409338-22409360 CAGCAAAGATGGAGAGAAAGTGG - Intergenic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1155692277 18:28639787-28639809 CAGTGAAGATGTGGAGAAATTGG - Intergenic
1155855199 18:30825488-30825510 TGGTTGAGATGGACAGAAATGGG + Intergenic
1155874209 18:31064847-31064869 GAATGGAGATGGAGACAAAAGGG + Exonic
1155970112 18:32075157-32075179 AAATGGAGGTGGTGAGAAATGGG - Intergenic
1156139605 18:34090873-34090895 CAGGGGTGGTGCAGAGAAATAGG + Intronic
1156851967 18:41739083-41739105 CAGGGGAGAGGGAGTGAGATGGG - Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157125870 18:44955312-44955334 CACTTGAGATGGGAAGAAATAGG + Intronic
1157477559 18:48033155-48033177 CAGGGCAGATGGAGAGAATCTGG + Intronic
1157630759 18:49093008-49093030 CTGAGAAGAAGGAGAGAAATAGG + Intronic
1157828162 18:50831282-50831304 CAGAGGGCATGGAGAGAGATTGG - Intergenic
1158049710 18:53201937-53201959 CAGTAGAGATGGATTGGAATGGG + Intronic
1158141357 18:54259802-54259824 AAAAGGAGAAGGAGAGAAATAGG - Intergenic
1158661550 18:59393051-59393073 GAGAAGAGATGGAGGGAAATGGG - Intergenic
1158777876 18:60608047-60608069 CTGTGGAAATGGATAGAACTAGG - Intergenic
1159046016 18:63368898-63368920 TAGTGAAGATGTAGAGAAATTGG - Intergenic
1159374002 18:67567226-67567248 CAGTGGTGATGGATAGGAAGAGG - Intergenic
1159425105 18:68275152-68275174 CAATGGGGACGGAGAGACATCGG - Intergenic
1159626383 18:70700149-70700171 AAGGGGAGATGGAGAGAAGCTGG - Intergenic
1159633431 18:70777073-70777095 AAGTAGAGTTGGAGGGAAATTGG + Intergenic
1160649285 19:213301-213323 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1161249195 19:3271239-3271261 CAGGGGAGGTGGGGAGAGATGGG - Intronic
1161501526 19:4618641-4618663 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501531 19:4618675-4618697 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501534 19:4618692-4618714 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501541 19:4618743-4618765 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501546 19:4618777-4618799 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501549 19:4618794-4618816 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501556 19:4618845-4618867 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501567 19:4618913-4618935 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501572 19:4618947-4618969 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501583 19:4619032-4619054 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501588 19:4619066-4619088 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501595 19:4619117-4619139 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501601 19:4619166-4619188 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501608 19:4619217-4619239 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501611 19:4619234-4619256 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501617 19:4619285-4619307 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501624 19:4619336-4619358 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501627 19:4619353-4619375 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501633 19:4619404-4619426 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501640 19:4619455-4619477 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501653 19:4619557-4619579 CAGAGGAGAGGGAGAGATAGAGG - Intergenic
1161501656 19:4619574-4619596 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1162614186 19:11783764-11783786 AAGGGGAAATGAAGAGAAATTGG + Exonic
1162776456 19:12982779-12982801 ACATGGAGATGGAGAGACATGGG - Intergenic
1163028933 19:14530934-14530956 AGGTGGAGGTGGAGAGGAATGGG - Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1164249683 19:23466023-23466045 CAGTGGAGGAGAGGAGAAATAGG - Intergenic
1164532491 19:29058878-29058900 CAGTTGAGAGAGAGTGAAATGGG + Intergenic
1165231083 19:34387214-34387236 CACTGGAGTTGGACACAAATAGG + Intronic
1165851037 19:38850443-38850465 CAGTGGAGACGCAGAAGAATGGG - Intronic
1166157086 19:40921822-40921844 CAGTGAAGATAGAGACATATGGG + Intergenic
1166305546 19:41935134-41935156 CAGGGGAGAGGGAGAGAGAGAGG + Intergenic
1166559766 19:43724596-43724618 CAGTGGAAATGCTGAGAAATTGG + Intergenic
1167435191 19:49474980-49475002 CAGAGGAGAGGGAGATAAAGAGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168167925 19:54565999-54566021 CAGTGGACAGGGAGAAAAGTAGG + Intergenic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925426970 2:3757873-3757895 CAGTGTTGATGGGGAGACATAGG - Intronic
925663579 2:6228668-6228690 CAGTGAAGATGGTCAGAAATAGG - Intergenic
926114982 2:10207265-10207287 CCATGGAGATGGAGAGAAAAGGG - Intronic
926400402 2:12490698-12490720 CAGAGGAGGAGGAGAGAAGTGGG - Intergenic
926449977 2:12991213-12991235 CAGAGGAGAGGGAGAGAGATGGG - Intergenic
926560051 2:14406863-14406885 CAGTGGAGATGAAGAAGAGTAGG - Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926803582 2:16684072-16684094 AAGTGGAGATGAAGAGAAACTGG - Intergenic
927158900 2:20240164-20240186 CAGTGGTGATGGGCAGAGATGGG + Intergenic
927375205 2:22405364-22405386 CAGGGGAGATGGGAAGAAACAGG + Intergenic
927439114 2:23097843-23097865 ATTTGGAGAAGGAGAGAAATTGG - Intergenic
927727172 2:25434841-25434863 TGGTGAAGATGTAGAGAAATTGG - Intronic
927801491 2:26104215-26104237 TAGTGAGGATGTAGAGAAATTGG - Intronic
927818220 2:26239566-26239588 CAGTGAAGGTGGAGTGGAATAGG + Intronic
928021533 2:27708693-27708715 CGGTAGAGATGGGGAGAGATGGG - Intronic
928067494 2:28180967-28180989 TAGTGAAGATGCAGAGAAAAGGG + Intronic
928232079 2:29506882-29506904 CAGTGAGGATGTAGAGACATTGG + Intronic
928443905 2:31316118-31316140 CTGTGGAAATGAAGAGACATGGG - Intergenic
928616229 2:33042432-33042454 CAGAGCAAAGGGAGAGAAATAGG + Intronic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
928867996 2:35941293-35941315 CAGTGTAGATCTGGAGAAATGGG + Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
928947406 2:36783744-36783766 AAGTGGAAATGAAGATAAATGGG + Intronic
929241665 2:39659779-39659801 CAGTGGAAACAGAGAGAAATGGG - Intergenic
929277504 2:40042078-40042100 AAGTGGAGGAGGAGAAAAATGGG + Intergenic
929441025 2:41965881-41965903 AAGGGGAGAGAGAGAGAAATGGG + Intergenic
929749967 2:44700554-44700576 CTGGGGAGAGGGAGAGAGATGGG + Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930403965 2:50930192-50930214 CAGTGAAGAAGGAGAAAAACTGG - Intronic
930875780 2:56213997-56214019 CAGTGAGGCTGGAGAGACATTGG + Intronic
930881887 2:56279434-56279456 CAGGGGTGAAGGGGAGAAATAGG - Intronic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931279609 2:60777780-60777802 CTGAGGAGAGGGAGAGAGATGGG + Intronic
931515418 2:63048231-63048253 GAGTGGAGAGGGAGAGAGACTGG - Intergenic
931666554 2:64613349-64613371 CAGTGGAGGAGGAGAGAGCTGGG - Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
931852629 2:66267528-66267550 CAGTGAAGATGTGGAGAAAAGGG - Intergenic
931908782 2:66871453-66871475 GAATTGGGATGGAGAGAAATGGG + Intergenic
932055070 2:68435018-68435040 CATGGGAGATGGGGAGAAAAAGG + Intergenic
932165082 2:69498501-69498523 CAGGGGAGGTGGGGAGAAAGAGG - Intronic
932324936 2:70852563-70852585 TGGTGGATATGCAGAGAAATTGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932759094 2:74427935-74427957 AATTGGACCTGGAGAGAAATGGG + Intronic
932807709 2:74797041-74797063 CAGTGGAGAGGGAGAGGGAGAGG + Intergenic
932819934 2:74890966-74890988 CAGGGAAGAAGGAGAGAAAGAGG - Exonic
932833007 2:75008687-75008709 CTGAAGAGATGGAGAGAAACAGG - Intergenic
933585994 2:84179982-84180004 AAGGGGAGATGGAAAGAAAAAGG + Intergenic
933641046 2:84760663-84760685 GAGTGAAGATGCAGAGAAAAGGG + Intronic
934129429 2:88933270-88933292 CAGTGCAGATGCAGATGAATTGG + Intergenic
934870892 2:97864237-97864259 CAGCGGGGATGGGTAGAAATGGG + Intronic
935193203 2:100794541-100794563 CAGCGGAGTGGGAGAGAAACAGG + Intergenic
935438103 2:103058773-103058795 AAGAATAGATGGAGAGAAATGGG - Intergenic
935551186 2:104457113-104457135 CAGTGAGGATGCAGAGAAACTGG - Intergenic
935793457 2:106615533-106615555 GAGTGGATTTGGGGAGAAATTGG + Intergenic
936574419 2:113641530-113641552 CAGGTGTGATGGAGAGAACTGGG + Intronic
936674160 2:114695207-114695229 TATTGGAGATGTAGTGAAATGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936806538 2:116339236-116339258 GAGTGGAGAAGAAGAGAATTTGG - Intergenic
937048841 2:118871609-118871631 CAGAGGAGCTGGAAAGAAGTAGG - Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937769751 2:125706561-125706583 CAGTGAGGCTGAAGAGAAATAGG + Intergenic
937783040 2:125861192-125861214 CAGTGGAGAAGGAAAAAAACTGG - Intergenic
937862050 2:126718945-126718967 CAGTGAGGATGGATAGAGATGGG + Intergenic
938227668 2:129629958-129629980 ATGTGGATATAGAGAGAAATAGG - Intergenic
938234407 2:129692140-129692162 AAGAGGAAATGGAGATAAATTGG + Intergenic
938558795 2:132451264-132451286 GAGTGGAAATAGAGAGTAATGGG - Intronic
939017981 2:136923590-136923612 TAATGAAGATGGAGAGAAATTGG - Intronic
939676436 2:145078197-145078219 CAGAGGACATGGAAAGAGATGGG - Intergenic
939706428 2:145458920-145458942 CAGTGGAGCTGGTGAGAACAAGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
939835386 2:147124138-147124160 GAGTAGAGAAGGAGAGAAATGGG + Intergenic
939928814 2:148206587-148206609 GAGGGGAGATGGAGAGAGACTGG - Intronic
939933665 2:148261907-148261929 TAGGGGAGAGGGAGAGAGATGGG + Intronic
940292005 2:152086391-152086413 CAGTTGTGTGGGAGAGAAATAGG - Intronic
940295110 2:152114516-152114538 CAGTGAGGATGTGGAGAAATTGG + Intergenic
940971568 2:159902330-159902352 CAGTGGTGTTTGAGAGAAAATGG + Intronic
941215619 2:162704667-162704689 AAAAGGAGATGGAAAGAAATTGG - Intronic
941700867 2:168603221-168603243 CATTGGTGATGGGAAGAAATGGG + Intronic
943040245 2:182796110-182796132 AAGTGGAGTTGGATTGAAATTGG + Intergenic
943740833 2:191406581-191406603 CCGAGGAGAGGGAGAGAGATGGG + Intronic
943901676 2:193446684-193446706 CAGTGAGGATGCAGAGAAAAAGG - Intergenic
944457179 2:199907849-199907871 CAGTTGAGAGGGAGAGGAGTGGG - Intergenic
944491290 2:200260291-200260313 GAGAGGAGATTGGGAGAAATAGG + Intergenic
944529572 2:200653999-200654021 CTGAGGAGAGGGAGAGAAATGGG - Intronic
945654544 2:212607156-212607178 CAGTGGAGGTGGTAAGAAATGGG - Intergenic
945683810 2:212944862-212944884 ACCTAGAGATGGAGAGAAATTGG + Intergenic
945712767 2:213320532-213320554 AAGGGGAGATGAAGAGAAATTGG - Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
946901246 2:224374016-224374038 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
946920315 2:224573942-224573964 TAGTGGAAATGGAAAGGAATTGG + Intronic
946950699 2:224871398-224871420 CAAGGGAGAAGGAGAGAAATGGG - Intronic
947971977 2:234332351-234332373 CAGGACAGATAGAGAGAAATGGG - Intergenic
948238992 2:236412980-236413002 CCGTGGAGATGGGGAGATGTGGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948481081 2:238251020-238251042 GAGTGGAGATGGTGAGAGCTTGG - Intronic
948670633 2:239566472-239566494 CAGTGGAGATGAAGAGAGACAGG + Intergenic
948879133 2:240847259-240847281 CAGCGGAGAGGGAGAGAAGGAGG - Intergenic
1169220939 20:3822360-3822382 GAGTGGGGACGCAGAGAAATAGG + Intronic
1169259842 20:4128871-4128893 CAGTGGAAATGAGGAGAAACTGG + Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169347188 20:4838113-4838135 CAGTGGATGTGGAGAGACAAGGG + Intergenic
1169642121 20:7764548-7764570 CATTTCAGATGGAGAGAAAAAGG + Intergenic
1169653886 20:7900656-7900678 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1169742625 20:8911747-8911769 CAGTAAAGATGTAGAGCAATTGG + Intronic
1169836702 20:9888278-9888300 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1169843492 20:9965140-9965162 CAGAGGAGATGAGGAGAAATGGG + Intergenic
1170287368 20:14724998-14725020 TTCTGGAGATGGAGACAAATGGG + Intronic
1170531270 20:17294833-17294855 CAGAGGAGATGGAGGAAAACAGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171251342 20:23651016-23651038 CCGAGGAGAGGGAGAGAGATGGG + Intergenic
1171796246 20:29568704-29568726 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1171851991 20:30315463-30315485 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1172624659 20:36340282-36340304 AAGTGGAGATGGTGAGGAAGGGG + Intronic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1173430381 20:42982612-42982634 CAGTGTAGATGGATCGAAAGGGG + Intronic
1173768228 20:45633199-45633221 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1173910723 20:46668047-46668069 CTGAGGAGAGGGAGAGAGATTGG - Intronic
1174052865 20:47779418-47779440 CAATGGAGATGGAGTGAAATGGG - Intronic
1174577623 20:51547840-51547862 CAGTGAAGTTAGTGAGAAATGGG - Intronic
1174579172 20:51558922-51558944 CAGTGGAGACTCACAGAAATAGG + Intronic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1174921783 20:54711008-54711030 CAGTGGAGAGGTGGAGAATTTGG - Intergenic
1175041439 20:56055397-56055419 CAGAGAGGATGCAGAGAAATAGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1176801300 21:13433216-13433238 CAGTGAAGATGCAGAGGAATTGG + Intergenic
1176946046 21:14982995-14983017 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1177709612 21:24755855-24755877 CAAGGGAGAGGGAGAGAAACAGG - Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177774347 21:25551272-25551294 CAGTAGAGATGGACAGATGTAGG + Intergenic
1177867860 21:26534533-26534555 GACTGGAGATGGAGAGGAAAGGG + Intronic
1178104604 21:29303924-29303946 CAGTGGGCATGCAGTGAAATTGG + Intronic
1178297655 21:31423875-31423897 CAAGGGAGTTGGGGAGAAATAGG + Intronic
1178596858 21:33962161-33962183 GAGTGGAGTTGGAGAGAAACAGG + Intergenic
1180148644 21:45936219-45936241 CAGTGGAGCAGGAGAAAAAGAGG + Intronic
1181088330 22:20455268-20455290 CTGTGGAGCTGGAGGGAGATGGG - Intronic
1181498914 22:23304702-23304724 CGGTGAGGATGTAGAGAAATGGG - Intronic
1181933146 22:26418954-26418976 CACTGGAGCTGGAGAGCAAGAGG + Intergenic
1181970978 22:26689848-26689870 AGGAGGAGAAGGAGAGAAATGGG - Intergenic
1182726573 22:32451735-32451757 AGGTGGAGATGGGGAGAAACAGG - Intronic
1182729806 22:32479026-32479048 CACTGGAGATGAAGAGACCTTGG + Exonic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183612553 22:38920018-38920040 CAGGGCAGAGGGAGAGAGATGGG + Intergenic
1183810139 22:40249156-40249178 CAGTGAAGATGGACACAAAGAGG - Intronic
1183842035 22:40506760-40506782 CAGTGAAAATGGTGATAAATGGG - Intronic
1184831212 22:46989545-46989567 CCGAGGAGAGGGAGAGAGATGGG + Intronic
1184968740 22:48000085-48000107 GAGTGGAGATGGGGAGAGGTTGG - Intergenic
1185096933 22:48814003-48814025 CAGAGGAGAGGGAGAGAGATGGG - Intronic
949380557 3:3440793-3440815 TAGTGAGGATGTAGAGAAATTGG + Intergenic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950130026 3:10536007-10536029 CGATGAAGATGCAGAGAAATTGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950252645 3:11479812-11479834 AAGTGGAGAAGGAGAGATACAGG - Intronic
950416127 3:12869834-12869856 CAGTGGAAATGAAAAAAAATAGG - Intronic
950700326 3:14740296-14740318 CCAAGGAGATGGAGAGAAACAGG + Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951245586 3:20337774-20337796 CAGTGGACTTGGAAAGAAATGGG + Intergenic
951350816 3:21604805-21604827 GAGAAGAGAAGGAGAGAAATGGG + Intronic
951433330 3:22633633-22633655 CAGTGAGGATGTGGAGAAATTGG - Intergenic
952201187 3:31129577-31129599 CTGAGGAGAGGGAGAGAAACAGG + Intergenic
952351842 3:32546793-32546815 CAGGAGAGATGGTGAGAAAATGG + Intronic
952552859 3:34498600-34498622 TGGTGGAGACGTAGAGAAATAGG + Intergenic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
953005963 3:38979680-38979702 CAGTGGAGATAGAGAGACTTTGG - Intergenic
953174443 3:40537022-40537044 CTGAGGAGAGGGAGAGAGATGGG - Exonic
953267063 3:41400814-41400836 TAGGGGAGATGCTGAGAAATTGG - Intronic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953767397 3:45754050-45754072 GAATGGATATGGAGAAAAATAGG - Intergenic
955071806 3:55577952-55577974 CACTGGAGAGGGAGAGAGAAAGG + Intronic
955211156 3:56942505-56942527 CTGAGGAGAGGGAGAGAGATGGG - Intronic
955290344 3:57686770-57686792 CTGAGGAGAGGGAGAGAGATGGG - Intronic
955416614 3:58697870-58697892 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
955789537 3:62574078-62574100 CAGTGGGGATGGAATGAGATGGG - Intronic
956176661 3:66479218-66479240 CAGAGGAAATGCAGAGAAAACGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956851716 3:73234098-73234120 CAGTGGAGATGGAGAAATTGAGG - Intergenic
956887103 3:73571254-73571276 CACTGGATATGGAGAAAAAAGGG - Intronic
957481420 3:80801880-80801902 CAGTGAGGATGCAGAGAAAATGG + Intergenic
957596036 3:82268077-82268099 TGGTGGAGAGAGAGAGAAATAGG + Intergenic
957955744 3:87184908-87184930 CTGAGGAGAAGAAGAGAAATAGG + Intergenic
958121633 3:89297404-89297426 CAGAGGAGAAGCAGAGAGATAGG + Intronic
958133442 3:89458653-89458675 CAGCGAAGATGCAGAGAAATAGG - Intronic
959107148 3:102077436-102077458 CAGTGGTCATGGAAAGAAATGGG + Intergenic
959578495 3:107960723-107960745 CAGTGGGGAGGGAGAGAGAAAGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960173335 3:114488594-114488616 TAGTGAGGATGCAGAGAAATGGG + Intronic
960231674 3:115235273-115235295 CAGTGGCCAAGGAGAGAAAGGGG + Intergenic
960258867 3:115542033-115542055 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
960407323 3:117277549-117277571 CAATGGAGATAGTAAGAAATAGG - Intergenic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960488647 3:118283085-118283107 CAGAGGAGAAAGAGAGAAAGAGG - Intergenic
960669001 3:120138943-120138965 CGGAGGAGAGGGAGAGAGATGGG - Intergenic
960691912 3:120355196-120355218 TGGTGCAGATGTAGAGAAATTGG + Intergenic
960773791 3:121225791-121225813 CAATGGAGATGTTGATAAATAGG + Intronic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
960875693 3:122293003-122293025 CAGAGGAGATGGAAAGACAGCGG + Intergenic
961350761 3:126300513-126300535 CAGGGGAGATGGGGAGCCATGGG - Intergenic
961658778 3:128457424-128457446 CAGTGCAGAGGGAGAGGAAGAGG + Intergenic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962465700 3:135656114-135656136 AAGAGGAGGTAGAGAGAAATAGG + Intergenic
962707224 3:138055908-138055930 CAGCAAAGATGGGGAGAAATAGG + Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
962932886 3:140053817-140053839 TTGTGGAGATGGAGTGAGATGGG + Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087446 3:141451271-141451293 TAGTGGGGATGGTAAGAAATGGG + Intergenic
963087610 3:141453121-141453143 CAGTGAAGATAGAGAGAAAGGGG + Intergenic
963384780 3:144577642-144577664 CAGTGAAGATGCACAGCAATTGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964128633 3:153263429-153263451 CAGGGAAGATACAGAGAAATAGG + Intergenic
964328127 3:155570342-155570364 CAGAGCTGATAGAGAGAAATAGG + Intronic
964400887 3:156297128-156297150 GAGTGGATGTGGACAGAAATGGG - Intronic
965046920 3:163590136-163590158 GAGTGGACATGGAGAGAGAATGG + Intergenic
965046971 3:163590963-163590985 TAGTGAAGAGGCAGAGAAATGGG - Intergenic
965464680 3:169013337-169013359 CAGTGCAGATAGAGAGAAGCAGG - Intergenic
965773439 3:172204980-172205002 TAGTGGAAATGGAGAGAGACGGG + Intronic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966431051 3:179832134-179832156 CAGTGGAGAACGAGAGAATTAGG + Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966542846 3:181111031-181111053 CAGTGAAGATCGGGAGAAATGGG - Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967180182 3:186896664-186896686 AAGTGGCAATGGTGAGAAATGGG - Intergenic
967229121 3:187320895-187320917 CAGTGGACCTGGAGAGGAAAAGG - Intergenic
967352257 3:188526827-188526849 TAGTTGAGAGGAAGAGAAATAGG + Intronic
967603646 3:191418099-191418121 CCGAGGTGAGGGAGAGAAATAGG - Intergenic
967983945 3:195081599-195081621 CAGTGTAGATGCAGAGAACCAGG - Intronic
968361059 3:198147231-198147253 CAGAGGAGATGCAGTGACATTGG + Intergenic
968368561 3:198206831-198206853 CAGTGAAGATGTGGAGGAATTGG - Intergenic
969984026 4:11188507-11188529 CAGTGGAGAAGCACAGAACTTGG - Intergenic
970105318 4:12575992-12576014 TAGTGGAAAAGGAGAGAAAAGGG + Intergenic
970538368 4:17053009-17053031 CATTGGAGAAGGAAATAAATAGG + Intergenic
970967176 4:21942201-21942223 CAGTGGATGTGGAAAGGAATGGG - Intronic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971408179 4:26341737-26341759 AAATGGAGTGGGAGAGAAATTGG + Intronic
971441266 4:26689768-26689790 CTGAGGAAAGGGAGAGAAATGGG - Intronic
971830837 4:31692611-31692633 CAGAGAAGAGGGAGAGAGATGGG - Intergenic
971883693 4:32414461-32414483 CAGAGAAGATGTGGAGAAATAGG + Intergenic
972358455 4:38304062-38304084 GGGTGGAGAGGGAGGGAAATGGG + Intergenic
972393335 4:38634052-38634074 GAGTGGAAATGAAGAGAAATGGG - Intergenic
972469848 4:39393706-39393728 CAGAGGAGATAGGGAGAGATTGG + Intergenic
972760640 4:42100141-42100163 AGGAGGAGATGGGGAGAAATTGG - Intergenic
973188650 4:47361652-47361674 CAGTGGTGATGGAAAAAAACTGG + Intronic
973336167 4:48958912-48958934 CAGTGGAAATGGAGAAGAAGAGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974456105 4:62130902-62130924 CAGTGGACAAGGCCAGAAATGGG - Intergenic
974831257 4:67192431-67192453 CAGTAGAAATGGAGAGATAAAGG - Intergenic
975023818 4:69524398-69524420 CAGAGGAGAGGGAGAGAGATGGG + Intronic
975641737 4:76507377-76507399 TGGTGAAGATGTAGAGAAATTGG - Intronic
976227012 4:82802333-82802355 CAGTGGGGATTTGGAGAAATTGG - Intergenic
976386233 4:84461901-84461923 CAGTGAAGTTAGAGAGGAATTGG - Intergenic
976681193 4:87757961-87757983 AAGGGGAGAGGGAGAGAAAGGGG + Intergenic
976857568 4:89623062-89623084 AAGAGGAAATGGAAAGAAATAGG - Intergenic
977145488 4:93434657-93434679 GAGTGGAAAGGGAGAGTAATTGG - Intronic
977356195 4:95950338-95950360 CAGTGGAAATGGAAAGATACGGG + Intergenic
977632109 4:99254570-99254592 CAAAGGAGATGGAGGAAAATAGG - Intergenic
978017734 4:103767975-103767997 CAGTGAGGATGTGGAGAAATTGG - Intergenic
978142511 4:105333926-105333948 AAGTGGTGATAGGGAGAAATTGG - Intergenic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
979108914 4:116725115-116725137 AAGTGGAGATGGCGAAAAGTAGG - Intergenic
979256985 4:118616554-118616576 CAGTGAAGATGTGGAGGAATTGG - Intergenic
979331365 4:119423992-119424014 CAGTGAAGATGTGGAGGAATTGG + Intergenic
979995156 4:127423551-127423573 TAGTGGAAATGAAGAGAAATAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981341017 4:143621321-143621343 GAGTGGAGCTGGAGAGGCATTGG + Intronic
981493012 4:145361191-145361213 CTGAGGAGAGGGAGAGAGATAGG - Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981798431 4:148627146-148627168 GAATGGGGATGGGGAGAAATGGG + Intergenic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982027235 4:151262992-151263014 CAGTTGAGAATGAGAGAAAAAGG + Intronic
982072298 4:151706113-151706135 CACTGGAGTTGGGGAGAGATGGG - Intronic
982152765 4:152480385-152480407 CTGAGGAGAGGGAGAGAGATAGG - Intronic
982166576 4:152618709-152618731 AAGTGGAGGTGGAGAGAAAGTGG - Exonic
983044689 4:162972042-162972064 TTTTGGAGATGGAGAGATATGGG - Intergenic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983672143 4:170250116-170250138 CATGGCAAATGGAGAGAAATGGG + Intergenic
983987405 4:174076269-174076291 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984577813 4:181472269-181472291 CAGTGGAGATGGAAACACAGGGG + Intergenic
984637137 4:182123518-182123540 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
984675125 4:182538698-182538720 TAGTGGAGTTGAAGAGAAGTGGG + Intronic
985451255 4:190065201-190065223 GAGGGGAGATGGGGAGACATTGG + Intergenic
986184794 5:5425158-5425180 CAGTGGAGATGTTGAAAAGTGGG - Intronic
986346339 5:6838818-6838840 CAGTGGAGATGCTGAGAAGCAGG + Intergenic
987040799 5:14060588-14060610 CAGTGTAGCTGGAGACAGATGGG + Intergenic
987453764 5:18118934-18118956 CAGTGGAAAGTGAGAAAAATAGG - Intergenic
987544435 5:19294633-19294655 GGGTGGAGATGAAGAGAGATTGG - Intergenic
987652829 5:20766265-20766287 AAGAGGAGATGAAGAGAAGTTGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
987750419 5:22031708-22031730 CAGAGGAGAAGGAGAGAGACAGG + Intronic
988208381 5:28170710-28170732 CAGTTGTGATGGAGATATATGGG - Intergenic
988742729 5:34095219-34095241 AAGAGGAGATGAAGAGAAGTTGG - Intronic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989459491 5:41681244-41681266 CAGGGTAGATTGAGAGATATTGG + Intergenic
989532380 5:42523618-42523640 CAGAGGAGAGGGAGAGAGATAGG - Intronic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
990058563 5:51617756-51617778 TAGAGGAGATGGAGAGAGGTTGG - Intergenic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
990481580 5:56216316-56216338 CTGAGGAGAGGGAGAGAGATGGG - Intronic
990501256 5:56398638-56398660 CAGTGGAGAGGGAGAGGGAGAGG + Intergenic
990738373 5:58888328-58888350 GAGAGGAGATGGAAAGAAACAGG - Intergenic
990801863 5:59613140-59613162 CCATGGTGATGGTGAGAAATGGG + Intronic
990831663 5:59965815-59965837 TAGTGGAGATGGAGACCATTCGG - Intronic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991104210 5:62825757-62825779 CAAAGGAGAGGGAGAGATATGGG - Intergenic
991126273 5:63073181-63073203 CAGTGGAAGTGGAAAGATATGGG - Intergenic
991487968 5:67157621-67157643 CAGGAGAGATGGAGAGGACTGGG + Intronic
991718159 5:69471391-69471413 GAGAGGATGTGGAGAGAAATAGG + Intergenic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
992351966 5:75939362-75939384 CAGGGGAGAGGGAGAGACAGAGG + Intergenic
992388684 5:76310642-76310664 CAATGGAGGTGGTGAGAAAGTGG + Intronic
992548405 5:77838023-77838045 AGATGGAGATGGAGAGAAAATGG + Intronic
993087837 5:83385769-83385791 CAGTGAGGATGGAGAAAAATTGG + Intergenic
993173081 5:84445780-84445802 CAGTAAAGATGGTAAGAAATAGG - Intergenic
993275980 5:85859305-85859327 CTGAGGAGAGGGAGAAAAATGGG + Intergenic
993709402 5:91209254-91209276 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
993805719 5:92406656-92406678 CTAAGGAGATGGAGAGAAATGGG - Intergenic
993930142 5:93927824-93927846 GAGGGGAGAGGGAGAGAAAAGGG + Intronic
995084173 5:108088419-108088441 CAGAGGAGAAGCAGAAAAATGGG - Intronic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
995298287 5:110545576-110545598 ATGTGGAGAAGGAGAGAAATAGG + Intronic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
995940970 5:117583357-117583379 TAGTGGAGACATAGAGAAATGGG - Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
997231793 5:132250857-132250879 CAGGGAAGATGAAGAGAAAATGG - Intronic
997459404 5:134041914-134041936 CAGAGGAGAGTGAGGGAAATGGG - Intergenic
997566649 5:134892814-134892836 CTGAGGAGAGGGAGAGAGATGGG + Intronic
997695080 5:135854986-135855008 CTGAGGAGAGGGAGAGAGATAGG + Intronic
998004167 5:138646354-138646376 CAGTGAGGATGGAGAGAGAGCGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998887995 5:146714823-146714845 CAGGGGAGAGGGAGAGAATAAGG - Intronic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
1000129270 5:158279743-158279765 CTGAGGAGATGGAGAGAGATGGG - Intergenic
1000216929 5:159167375-159167397 CAGAGGAGATTTAGAGAAAAAGG - Intronic
1000452892 5:161412395-161412417 CAGTGGAGATGGTAAGGAATCGG - Intronic
1000790205 5:165597381-165597403 CAGTCGGGATGTTGAGAAATGGG - Intergenic
1001047430 5:168385501-168385523 GAGTAGAGGTGAAGAGAAATGGG - Intronic
1001054790 5:168440314-168440336 TGGTGAAGATGTAGAGAAATTGG + Intronic
1001237454 5:170042264-170042286 GAATGGAGATGGAGAGGAAGTGG - Intronic
1001284385 5:170411913-170411935 CAGGGTAGATGGAGAGAGAGAGG + Intronic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001923200 5:175616917-175616939 CAGTGGTGATGGAGGGACAAGGG + Intergenic
1001969443 5:175942608-175942630 CAGTGAGGATGTAGAGAAAAGGG + Intronic
1002247992 5:177901145-177901167 CAGTGAGGATGTAGAGAAAAGGG - Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002727782 5:181312058-181312080 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003426824 6:6003362-6003384 CAGGGGAGGAGGAGAGAAAGAGG - Intronic
1003653393 6:7983368-7983390 AAATGGAGAGCGAGAGAAATGGG - Intronic
1003682399 6:8269040-8269062 CAGTGGTGATGGAGAAAACCAGG + Intergenic
1003719291 6:8682477-8682499 CAGTCAAGATGGAGGGAGATGGG - Intergenic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1005529706 6:26690473-26690495 GAGTGGAGATGGAAAGAAAAGGG + Intergenic
1005541090 6:26811174-26811196 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1005676226 6:28158246-28158268 CAGTGGAGAAGAGGAGAAAGGGG - Exonic
1006026666 6:31151332-31151354 CAGTGGAGACGGAGACAGAGAGG - Intronic
1006042392 6:31267221-31267243 CAGTGGAGATGGGGAGACTCTGG - Intergenic
1006051979 6:31352309-31352331 CAGTGGAGATGGGGAGACTCTGG - Intronic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006609570 6:35286098-35286120 GAGTGGAAATAGAGAGAAATGGG - Intronic
1006880899 6:37338816-37338838 CAGAGAGGATGTAGAGAAATAGG - Intergenic
1006898961 6:37487816-37487838 CAGTGGAACTGCAGATAAATTGG - Intronic
1007597871 6:43062736-43062758 CAGTGGAGGTAGTGGGAAATTGG + Intronic
1008100153 6:47381318-47381340 CAGTCCAGATGGAGAGATTTAGG + Intergenic
1008237487 6:49067821-49067843 CAGTGAAGATGTAGAGGAAAGGG + Intergenic
1008309116 6:49943218-49943240 CAGTTGAGATAGACAGAAATGGG + Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1009011903 6:57853262-57853284 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1009749944 6:67869947-67869969 CTGATGAGAAGGAGAGAAATTGG + Intergenic
1010016585 6:71111174-71111196 TATTGGAGATGGAGAGAAAATGG - Intergenic
1010538807 6:77064916-77064938 TGGTGGAGATGAAGAGAAACTGG - Intergenic
1010704149 6:79087840-79087862 AAATTGAGTTGGAGAGAAATAGG + Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011637789 6:89390520-89390542 TAGTGAAGATGTAGAGAAACTGG + Intronic
1012117089 6:95314674-95314696 CAGGGGAGTGGGAGAGGAATTGG + Intergenic
1012464734 6:99504536-99504558 CAGAGGATCTGGAGAGAAATGGG + Intronic
1012836725 6:104278927-104278949 CAGAGGAGATGAACAGACATGGG + Intergenic
1013668193 6:112369600-112369622 CTGTGGAGGGGAAGAGAAATTGG + Intergenic
1013708806 6:112873111-112873133 TAGTGAGGATGTAGAGAAATAGG + Intergenic
1014023428 6:116616892-116616914 CAGGGGAGAAGGAGAGGAAGAGG - Exonic
1014137321 6:117905433-117905455 CAGAGGAGATGTAGAGCATTTGG + Intergenic
1014340326 6:120197530-120197552 GAGTGGAGATGGAAAGCACTAGG + Intergenic
1015648290 6:135421043-135421065 CTGAAGAGAGGGAGAGAAATGGG + Intronic
1015857832 6:137644569-137644591 GGGGGGAGATGAAGAGAAATGGG - Intergenic
1015873466 6:137799948-137799970 CAGCTGAGATGTAGAGAAAAGGG - Intergenic
1015906633 6:138123647-138123669 CAGAGAAGATGGAGAGGGATGGG - Intergenic
1015913903 6:138195431-138195453 CAGAGGAGAGGGGGAGAGATTGG - Intronic
1015918623 6:138244288-138244310 CAAGGAAGATGGAGAGAAAATGG - Intronic
1016235699 6:141862827-141862849 CGCTGCAGATTGAGAGAAATGGG + Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016616939 6:146061058-146061080 CTGTGGAGAGGGAGAGAGATGGG + Intronic
1016692269 6:146951291-146951313 CAGAGGAGATGGAGACAGAGTGG - Intergenic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1017104167 6:150872460-150872482 CAGAGGAGAGGGAGAGAGAAGGG + Intronic
1017242107 6:152181906-152181928 TGGTGAAGATGTAGAGAAATTGG - Intronic
1017243727 6:152198687-152198709 CAGAGGAGAAGGAGAGAGATTGG + Intronic
1017583353 6:155892266-155892288 GAGTAGAGATGTGGAGAAATTGG + Intergenic
1017734674 6:157350484-157350506 CTGAGGAGAGGGAGAGATATAGG - Intergenic
1018266534 6:162030289-162030311 CAGTGGAGATGGGCAGATAACGG - Intronic
1018598251 6:165507661-165507683 AAGTGGAGAGGAAGAGAAAAAGG - Intronic
1018715682 6:166530775-166530797 CAGAGGAGCTGGGCAGAAATCGG + Intronic
1018994578 6:168701296-168701318 CAGGGGAGAGGCGGAGAAATGGG - Intergenic
1019087495 6:169493543-169493565 TAGTGGAAATGGAGAAAAACAGG - Intronic
1019258950 7:69423-69445 CAGAGGAGATGCAGTGACATTGG - Intergenic
1020127454 7:5541028-5541050 GGGTGGAGAAGGAGAGAAAAGGG + Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021176620 7:17457505-17457527 GAATGGAGATGGACAGACATGGG - Intergenic
1021296132 7:18908532-18908554 GAGTGGAGAGAGGGAGAAATAGG - Intronic
1021354221 7:19634273-19634295 TAGAGAAGATGTAGAGAAATGGG + Intergenic
1021376569 7:19915143-19915165 CTGAGGAGCAGGAGAGAAATGGG + Intergenic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022483962 7:30763506-30763528 CAGGGGAGAGGGAGAGCAAGAGG + Intronic
1022488369 7:30797860-30797882 CAGTGAAGGTGGTGAGACATGGG + Intronic
1022594545 7:31699954-31699976 CAGGGGAGAGGGAGAGAGATAGG - Intronic
1022729604 7:33010082-33010104 CAGGGAAGATGGAGAGGAATAGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022762408 7:33369662-33369684 CTATGGTGATGGAGAGAGATAGG + Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023099980 7:36707250-36707272 CAATGGAGAGGGGGAGAGATGGG + Intronic
1023149167 7:37183555-37183577 CAGAAGAGAGAGAGAGAAATAGG + Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1023773250 7:43579289-43579311 CTGAGGAGAGGAAGAGAAATGGG + Intergenic
1023932087 7:44712253-44712275 CAGAGGTGTTGGAGGGAAATGGG + Intergenic
1024071910 7:45793627-45793649 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1024089798 7:45925824-45925846 CACTGGAGATGGAGAGACGGAGG + Intergenic
1024280768 7:47717688-47717710 CAGTGAGGAAGAAGAGAAATTGG + Intronic
1024316544 7:48024514-48024536 TAGTGGAAATGTAGAGAAATTGG + Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1025185282 7:56852871-56852893 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1025686649 7:63724088-63724110 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1025978131 7:66385759-66385781 CAGGAGAGAGGGAGAGAATTAGG - Intronic
1026567240 7:71499676-71499698 CTGTATAGATGAAGAGAAATCGG - Intronic
1027271291 7:76520548-76520570 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027294163 7:76749906-76749928 CAGAGGAGAGGGAGGGAGATGGG - Intergenic
1027321055 7:77010483-77010505 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027691903 7:81358151-81358173 AAGGAGAGAGGGAGAGAAATAGG - Intergenic
1028101785 7:86829605-86829627 CTGAGGTGATGGAGAGAGATAGG + Intronic
1028191112 7:87853334-87853356 TAGTGAAGATGTGGAGAAATTGG + Intronic
1028210079 7:88062849-88062871 CTGTGGAGAGGGAGGGAGATGGG + Intronic
1028437547 7:90821810-90821832 CACTGAAGATAGGGAGAAATTGG - Intronic
1028768606 7:94589341-94589363 CAATGGAGATGGGGAGGAATGGG - Intronic
1028831106 7:95327422-95327444 CAGTGGAAATGGGGAAAATTGGG - Intergenic
1029013269 7:97285526-97285548 GAGTGGAGAAGGAAAGAAACTGG - Intergenic
1029876905 7:103763907-103763929 CAGTGGGCATGGAAAGAAAGGGG + Intronic
1030200170 7:106895223-106895245 CAGTTGAGAAGGAGAGAATGAGG + Intronic
1030218120 7:107067332-107067354 AAGTGGAAATGGAGGGATATGGG + Intronic
1030594852 7:111525576-111525598 TAGTGGAGATGGATTAAAATGGG + Intronic
1030704561 7:112678091-112678113 AGATGGAGATGGAGAGAACTGGG + Intergenic
1031026191 7:116682775-116682797 CAGTGGGCATGGCGAAAAATTGG - Intronic
1031150117 7:118044467-118044489 TATTGGTAATGGAGAGAAATAGG + Intergenic
1031350979 7:120730799-120730821 ATATGGAGATGGAGAGGAATTGG - Intronic
1031586077 7:123533766-123533788 GCCTGGAGATGGGGAGAAATGGG + Intronic
1031815286 7:126426156-126426178 CTGAGGAAAGGGAGAGAAATGGG + Intergenic
1032049294 7:128637334-128637356 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032440896 7:131942215-131942237 TAGTGAAGATGTGGAGAAATTGG + Intergenic
1032586345 7:133150614-133150636 CACTGGAGATAGAAAGAAAGTGG - Intergenic
1032607533 7:133371867-133371889 CAGTAAGGATGCAGAGAAATTGG - Intronic
1032630160 7:133642423-133642445 CAAAGGGGATGGAGGGAAATAGG - Intronic
1032653457 7:133903411-133903433 CAGCAGAGATGGAGGGAACTGGG + Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033767025 7:144505431-144505453 GACTAGAGAAGGAGAGAAATAGG - Intronic
1034309596 7:150075340-150075362 GAAGGGAGATGAAGAGAAATAGG - Intergenic
1034797263 7:154025301-154025323 GAAGGGAGATGAAGAGAAATAGG + Intronic
1035173465 7:157033753-157033775 CCGTGCAGATGGACAGAAAGGGG - Intergenic
1035332546 7:158105723-158105745 CAATGGAGATGGATAGAGCTGGG - Intronic
1035739345 8:1914405-1914427 CAGGGGCCAGGGAGAGAAATCGG - Intronic
1035852218 8:2932042-2932064 AAGAGGAGAAAGAGAGAAATTGG + Intergenic
1036108074 8:5863666-5863688 CTGAGGAGATGGAGAGAGACAGG + Intergenic
1036485211 8:9173202-9173224 CAGTTGAGATGGAAAGAAAGTGG - Intergenic
1036757639 8:11481783-11481805 CAATGGAGATGGGGAAAAGTGGG + Intergenic
1036787333 8:11696990-11697012 CCGGGGAGATGGTGTGAAATAGG + Intronic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1038375975 8:27040843-27040865 CATAGCAGATGGTGAGAAATGGG + Intergenic
1038914390 8:32004245-32004267 CAGTGGATGGGGAGGGAAATGGG + Intronic
1039147551 8:34465673-34465695 CAGTGTAGATGGACTGATATGGG - Intergenic
1039706857 8:40016105-40016127 CAGTGGAGATGGGAAGATAGAGG + Exonic
1040061382 8:43106127-43106149 TGGTGAAGATGCAGAGAAATGGG - Intronic
1040437400 8:47404711-47404733 GAGAGGATGTGGAGAGAAATAGG + Intronic
1040636273 8:49277244-49277266 CAGAGGAGAGGGAGAGAGACAGG - Intergenic
1040732407 8:50464483-50464505 CTGCAGAGAGGGAGAGAAATGGG + Intronic
1040756911 8:50787353-50787375 TAGTGAGGATGTAGAGAAATTGG + Intronic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041878226 8:62715084-62715106 CAGAGGAGAGAGAGAGAAGTAGG + Intronic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042408099 8:68429399-68429421 TGGTGAAGATGTAGAGAAATGGG + Intronic
1042633086 8:70842844-70842866 TATTGGAGCTGGAGAGAAAAAGG - Intergenic
1042838598 8:73100923-73100945 AATTGGAGATGGAAAGAACTAGG + Intronic
1042882413 8:73508359-73508381 CTGAGGAGATGGAGAGAGATGGG + Intronic
1042943452 8:74130964-74130986 CTGGGGAGATGGAGAGAGTTGGG + Intergenic
1043294083 8:78642850-78642872 AAGTGAAGATGTAGAGAAAAGGG - Intergenic
1043689553 8:83133026-83133048 CTGATGAGATGTAGAGAAATGGG + Intergenic
1043714354 8:83462840-83462862 AAGGGGAGGAGGAGAGAAATAGG - Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044133409 8:88555508-88555530 TGGTGAAGATGTAGAGAAATTGG - Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046120858 8:109844981-109845003 GAGTGGAGATGAAGAGAGGTTGG - Intergenic
1046147053 8:110174015-110174037 AGGTGGAGAGGGGGAGAAATGGG + Intergenic
1046167551 8:110457048-110457070 AACTGGGGATGAAGAGAAATGGG + Intergenic
1046424025 8:114022741-114022763 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
1046726088 8:117675421-117675443 CAGTGGAGATGGATAAAGACTGG + Intergenic
1047009897 8:120660882-120660904 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047438889 8:124858802-124858824 CAGAGGTGATGGAGAGGAAGTGG - Intergenic
1047634485 8:126744996-126745018 CAGTGAAGATGAAGAAAAGTAGG + Intergenic
1047703625 8:127474902-127474924 CAGAGGAGATGGGGAGAGATGGG - Intergenic
1047880212 8:129184584-129184606 TGGTGAAGATGTAGAGAAATTGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1047984905 8:130222510-130222532 CAGTGGAGAAGGATAGGATTTGG - Intronic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048008759 8:130440120-130440142 CAATGGAGGTAGAGAGAAGTGGG - Intronic
1048065140 8:130960114-130960136 CAGTGGAGATGGAGAAACATGGG + Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048275551 8:133063106-133063128 CACTGGAGATGGTGGCAAATGGG - Intronic
1048324329 8:133427489-133427511 CAATGAAGCTGGAGAGAAAAGGG + Intergenic
1048548914 8:135415498-135415520 CACAGGAGAGGGAAAGAAATTGG - Intergenic
1048902468 8:139051947-139051969 CCAAGGAGATGGAGAGAGATGGG - Intergenic
1049032021 8:140045115-140045137 CAGCAGAGATGGAGAGGAAAAGG + Intronic
1049129183 8:140821364-140821386 TAGTGGTGAAGAAGAGAAATGGG + Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049533746 8:143168612-143168634 AAGTGGAGAGGGAAAGAAAGAGG + Intergenic
1050085068 9:1956562-1956584 AAGAGGAGATGGAGAGAGGTTGG + Intergenic
1050580041 9:7044494-7044516 CAGTGATGATGGAGAGAACAGGG + Intronic
1050693919 9:8258926-8258948 CAGTGTACTGGGAGAGAAATGGG + Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051123750 9:13780383-13780405 CTGAGGAGAGGGAGAGACATGGG - Intergenic
1051294575 9:15582288-15582310 GAGAGGAGATGTGGAGAAATAGG + Intronic
1051721617 9:20042968-20042990 CCAAGGAGAAGGAGAGAAATGGG - Intergenic
1052541193 9:29813201-29813223 GAGAGGAAATGGACAGAAATAGG + Intergenic
1052667884 9:31518499-31518521 CCGTGAAGATGGGGAGAAACAGG - Intergenic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053789774 9:41678717-41678739 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054155367 9:61636036-61636058 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054178114 9:61890407-61890429 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054475153 9:65567147-65567169 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054659415 9:67690417-67690439 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054752981 9:68927404-68927426 CAGTGAGGATGTAGAGAAACTGG - Intronic
1054803172 9:69372809-69372831 CAGTGAAGATGTGCAGAAATTGG - Intronic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055124400 9:72702592-72702614 CAAGAGAGATGGAGAGAATTTGG + Intronic
1055495435 9:76849983-76850005 CAGAGGACATGCAGAGAAAAGGG - Intronic
1056139128 9:83657480-83657502 CAGTGGAGGTGGTAAGAAGTTGG - Intergenic
1056198838 9:84255053-84255075 CAGTTGAGCTGCAGAGAAAATGG + Intergenic
1056578825 9:87875735-87875757 AAGAGGAAAGGGAGAGAAATTGG + Intergenic
1056749972 9:89342292-89342314 CAGTGAAGATGTGGAAAAATTGG + Intronic
1057220605 9:93255904-93255926 CAGACGATATGGAGAGAAACGGG - Intronic
1057725438 9:97564903-97564925 AAGTGGAGAAGGAAAGAAAGTGG - Intronic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1057919327 9:99083760-99083782 CAGTGGATGTGGTGAGAAGTGGG + Intergenic
1057992902 9:99790807-99790829 TAGGGGAGATAAAGAGAAATTGG - Intergenic
1058165311 9:101612214-101612236 CAGTGGAGATGACAATAAATGGG + Intronic
1058211509 9:102175098-102175120 CTTTGGATATGGTGAGAAATAGG + Intergenic
1058266482 9:102905238-102905260 CGGTGAGGATGCAGAGAAATAGG + Intergenic
1058596962 9:106625282-106625304 AAGTTGAGATGGAGAGCCATGGG + Intergenic
1058732292 9:107861922-107861944 AAGAGCAGATGGAGAGAAGTGGG + Intergenic
1058880827 9:109284832-109284854 CAGTGGCAATGGATAGTAATAGG - Intronic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059070872 9:111134520-111134542 CAGTGGAGATTAAGAGACAAGGG + Intergenic
1059295962 9:113271027-113271049 CAGTGGAGATGAAAAGGTATGGG + Intronic
1059833647 9:118126659-118126681 CTGAGGAGAGGGAGAGACATGGG - Intergenic
1059975275 9:119709557-119709579 CAGTGTAGTTGGAGTGAATTAGG - Intergenic
1060041363 9:120304352-120304374 CCGTGGAGATGGAGAGGGAGAGG - Intergenic
1060051211 9:120379729-120379751 CAGCTGAGATGGAGAGACACAGG + Intergenic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061221427 9:129254217-129254239 CCTTGGAGAGGGAGAGAGATAGG + Intergenic
1061390342 9:130314227-130314249 GAGGGGAGTTGGGGAGAAATGGG + Intronic
1061414902 9:130442337-130442359 AAGTGGAAGTGGAGAGAAAGGGG + Intergenic
1061776226 9:132966706-132966728 CAGTTATGATGGAGAGAACTGGG + Intronic
1061784316 9:133017005-133017027 CTGTGGAAAGGGAGAGAGATGGG - Intergenic
1062675123 9:137738413-137738435 CAGTGAGGATGCGGAGAAATGGG + Intronic
1062745769 9:138211059-138211081 CAGAGGAGATGCAGTGACATTGG + Intergenic
1062752902 9:138269536-138269558 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1203575418 Un_KI270745v1:4310-4332 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1186554363 X:10541881-10541903 CAGTGGAGATGCCTAGCAATGGG - Intronic
1186693002 X:11999219-11999241 CTGTGGACATGGATAGAAACAGG - Intergenic
1187035979 X:15539939-15539961 GAGAGGATGTGGAGAGAAATAGG + Intronic
1187423909 X:19160384-19160406 CAGTGCAATTGGAGAGAACTAGG - Intergenic
1187872618 X:23777094-23777116 TGGTGTAGATGTAGAGAAATTGG + Intergenic
1188291446 X:28393611-28393633 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1188540555 X:31245819-31245841 CAGAGGAGAGGGAAAGAGATGGG - Intronic
1189181420 X:39008250-39008272 AAGGGGAGAGGGAGAGAAAGGGG + Intergenic
1189338681 X:40187487-40187509 CAGAGTGGATGGAGGGAAATGGG + Intergenic
1189372380 X:40439031-40439053 AAGTGGAGAGGGAGGGAAAGGGG + Intergenic
1189570405 X:42289892-42289914 CAGAGGAGACAGAGAGAAAGAGG - Intergenic
1189684421 X:43549186-43549208 CAGTGGATATGGGAAGATATAGG - Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190414609 X:50168457-50168479 CGGTGAAGATGTGGAGAAATGGG + Intergenic
1190583211 X:51908853-51908875 CACTGGGGATGCGGAGAAATTGG - Intergenic
1191053189 X:56216143-56216165 AAGTGAAGATGAAGAGAAGTAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191130326 X:57001216-57001238 GAGTGAAGATGTGGAGAAATTGG - Intergenic
1191186536 X:57619216-57619238 CGGTGAAGTTGGGGAGAAATAGG + Intergenic
1191219506 X:57972724-57972746 TTGTTGATATGGAGAGAAATGGG + Intergenic
1191887264 X:65901474-65901496 CAGTGGTGATGGGAAGAATTAGG + Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192373726 X:70537913-70537935 CATTGGTGATGAAGAGATATAGG + Intronic
1192658500 X:73017974-73017996 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1193491143 X:82149423-82149445 AAGAGGAAATGGAGAGATATTGG + Intergenic
1193671466 X:84391583-84391605 TAGTGAGGATGCAGAGAAATAGG - Intronic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1193951572 X:87807302-87807324 TAATGGAGATGGAGAGTAATAGG - Intergenic
1195003091 X:100661126-100661148 TTGTGAAGATGGAGAGAAACTGG - Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195430210 X:104780689-104780711 CATGGCAGATGGAGAAAAATAGG - Intronic
1195502617 X:105619704-105619726 CAGTTGAGACAGAGAAAAATAGG + Intronic
1195522308 X:105845395-105845417 AAGTGGGGAAAGAGAGAAATAGG + Intronic
1195598918 X:106724254-106724276 TAGTGGACATGAAGAGAAGTGGG - Intronic
1195910064 X:109880450-109880472 CAGAGGAGATGGGGAGAAGCAGG - Intergenic
1196063906 X:111441804-111441826 CTCTGGAAAGGGAGAGAAATGGG + Intergenic
1196903224 X:120407134-120407156 AAGTGGGGATGGATAGAAATGGG - Intergenic
1197006195 X:121501765-121501787 CAGTGAAGATTTAGAGAAACAGG - Intergenic
1197462339 X:126757761-126757783 CTGTGGAGATGCATAGATATTGG + Intergenic
1197490240 X:127107397-127107419 CAGAGAAGATGTAGAGAAACAGG + Intergenic
1197973460 X:132139438-132139460 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198281417 X:135146520-135146542 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1198289542 X:135225996-135226018 CTGAGGAGAAGGAGAGAGATGGG - Intergenic
1198323142 X:135539794-135539816 CTGAGGAGAGGGAGAGAGATAGG + Intronic
1198490593 X:137136394-137136416 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1199103021 X:143827994-143828016 CTGAGGAGATGAAGAGAGATAGG - Intergenic
1199196634 X:145039535-145039557 CAGAGAAGAGGGAGAGAGATGGG - Intergenic
1199480354 X:148291619-148291641 CAATGGAGATACAAAGAAATGGG - Intergenic
1199497451 X:148468776-148468798 AAGTGGAGTTGGAAAGAAAGAGG + Intergenic
1199599859 X:149535464-149535486 GAAGGGAGAAGGAGAGAAATAGG - Intergenic
1199650785 X:149944805-149944827 GAAGGGAGAAGGAGAGAAATAGG + Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199784112 X:151089140-151089162 TAGTGGATATTGAGAGAAATTGG - Intergenic
1199941304 X:152630495-152630517 GAGTGAAGAAGAAGAGAAATAGG - Intergenic
1200020238 X:153197855-153197877 CAGAGGAGAGGGAGAGGCATGGG - Intergenic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1201606648 Y:15792953-15792975 AAGGGGAGAGGGAGAGAAACAGG - Intergenic
1201663801 Y:16426790-16426812 TAGGGAAGAAGGAGAGAAATGGG - Intergenic
1201938475 Y:19433185-19433207 CAGTGCAAAAGGAGAGAATTAGG + Intergenic
1201963496 Y:19707489-19707511 CAGTGGAGATGAAGTGAGACTGG + Exonic
1202370231 Y:24191255-24191277 CAGTGGTGCTGCAGAGAAATTGG + Intergenic
1202500553 Y:25478862-25478884 CAGTGGTGCTGCAGAGAAATTGG - Intergenic