ID: 962927090

View in Genome Browser
Species Human (GRCh38)
Location 3:140004933-140004955
Sequence GGTCCCAGTGGACCAATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962927090_962927094 18 Left 962927090 3:140004933-140004955 CCTTCTATTGGTCCACTGGGACC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 962927094 3:140004974-140004996 ACAAGTGCTGTTGCATTAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
962927090_962927093 15 Left 962927090 3:140004933-140004955 CCTTCTATTGGTCCACTGGGACC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 962927093 3:140004971-140004993 AAAACAAGTGCTGTTGCATTAGG 0: 1
1: 0
2: 1
3: 25
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962927090 Original CRISPR GGTCCCAGTGGACCAATAGA AGG (reversed) Intronic
903056226 1:20638043-20638065 GGTACCAGTGCACCAGGAGAAGG + Exonic
903298020 1:22358059-22358081 GGTTCCAGTGGATCAATCAATGG + Intergenic
904026635 1:27508026-27508048 GGTTCCAGTGGACAAGTGGAGGG - Intergenic
904289142 1:29472370-29472392 AGTCCCAGTGGACCACAAGTCGG + Intergenic
905000647 1:34665962-34665984 AGTCTAAGTGGACCAACAGATGG + Intergenic
914975971 1:152362668-152362690 GGTCCAAGTGGACAGATAGCAGG + Intergenic
916676175 1:167065944-167065966 GGTCCCCGGGGAACAAGAGAAGG + Intronic
922353204 1:224752331-224752353 GGTCCCAGTGGGCATATGGATGG - Intergenic
1064223117 10:13458726-13458748 GGTCCCAGGGGACAAGCAGAGGG + Intronic
1065721984 10:28636131-28636153 GGGCCCAGTGATCCAATGGAGGG + Intergenic
1074357710 10:112800624-112800646 GGCCCCATTTTACCAATAGAGGG + Intronic
1084480265 11:69415948-69415970 GGTCCCTGAGGTCCCATAGAGGG + Intergenic
1084484085 11:69437987-69438009 GGCCCCAGTGCAGCAAGAGAGGG - Intergenic
1085127438 11:74011297-74011319 GGGCCCAGGGGACCTAAAGAGGG - Intergenic
1103305739 12:119962593-119962615 GGGCCCACTGGACCCATGGAAGG - Intergenic
1103898555 12:124291085-124291107 GGTCCCAGTGGACCGTGACATGG - Intronic
1104686299 12:130787305-130787327 GGTCCCATGGGACCAAGACATGG - Intergenic
1110909588 13:80939842-80939864 GGTCCCAGTGGACCAATTTTGGG + Intergenic
1117247719 14:53902268-53902290 GGGCCCTCTGGACCAAAAGATGG - Intergenic
1125424243 15:39533468-39533490 GGACCCTGTGGCCCAATAAAGGG - Intergenic
1138615293 16:58160614-58160636 GGTCCCAGTGGACTGAAAGGTGG - Intronic
1140194812 16:72847451-72847473 GCTCCCAGGGTACCAAGAGATGG - Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147066026 17:37923190-37923212 GGTGCCAATGGATGAATAGATGG + Intergenic
1156842399 18:41624833-41624855 GGTCTCAGTGTACCCTTAGAAGG - Intergenic
1158410425 18:57200346-57200368 GGTCCCAGTAGACCAAAGGAAGG - Intergenic
1165015903 19:32879825-32879847 GGTCACAGTGGACAAGCAGACGG - Intronic
1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG + Intronic
936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
1172804404 20:37601043-37601065 TGTCCCATTGGAGAAATAGAAGG - Intergenic
1173235634 20:41243105-41243127 GTTCCCAGTGCTCCAAGAGAGGG + Intronic
1181849952 22:25742938-25742960 GGTCCCAGTGGCCCCATAGTGGG + Intronic
1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG + Intronic
958141435 3:89567514-89567536 GGTCCCAATGCAACAATAGCTGG + Intergenic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
978540118 4:109807606-109807628 GGACACAGTGGACAACTAGAAGG - Intergenic
988543363 5:32133413-32133435 GTTCCCAGCTGACCAAAAGAAGG - Intronic
990717064 5:58649167-58649189 GCTCCCAGTGGACCAGCAGGTGG - Intronic
995269861 5:110207867-110207889 AGTCCCAGTGGGCCCCTAGAGGG - Intergenic
1002254602 5:177949872-177949894 GGCCCCCGTGGACCAGCAGAGGG + Intergenic
1002483390 5:179517940-179517962 GGCCCCCGTGGACCAGCAGAGGG - Intergenic
1011497719 6:87952846-87952868 GGCACCAGTTGACCATTAGATGG + Intergenic
1013481686 6:110558394-110558416 GGTCCCAGAGGACCAAGTAAAGG + Intergenic
1014308518 6:119770656-119770678 GGCCCCAGTGGACTATCAGAGGG + Intergenic
1019026669 6:168971381-168971403 TGCCCCAGTGGACCAAAAGTTGG - Intergenic
1021722860 7:23520753-23520775 GGTTGCAGTGAACCAAGAGATGG - Intronic
1022329778 7:29366542-29366564 GATCCCAATGAACCAATACATGG - Intronic
1031754371 7:125619082-125619104 GATCCCAGGAGACCAAAAGATGG - Intergenic
1036628584 8:10494029-10494051 GTTCCCAGTAGTCCAAGAGATGG + Intergenic
1045207708 8:100059672-100059694 GGTCCCAATGCAACAATAGCTGG + Intronic
1055374862 9:75637666-75637688 GGTTCCAGTGCACTAGTAGATGG + Intergenic
1061251714 9:129430231-129430253 GATCCCAGTGGACCCTGAGAGGG - Intergenic
1062650579 9:137574760-137574782 TTTCCCAGTGGACCAATCTAGGG + Exonic
1187297034 X:18012078-18012100 GGGTCCAGCAGACCAATAGAGGG + Intergenic
1191160877 X:57328938-57328960 GGTCCTCCTGGACCACTAGAAGG + Intronic
1192179587 X:68908188-68908210 AGTCTGAGTGGACCAAGAGATGG + Intergenic
1197527384 X:127578867-127578889 GGTCTCAGTGTAATAATAGATGG - Intergenic
1197865748 X:131014859-131014881 GGTCCCAGTGCAGCAATGGGGGG + Intergenic
1197913719 X:131513361-131513383 GGGCCCATTGCACCAATTGATGG - Intergenic