ID: 962927093

View in Genome Browser
Species Human (GRCh38)
Location 3:140004971-140004993
Sequence AAAACAAGTGCTGTTGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 228}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962927089_962927093 16 Left 962927089 3:140004932-140004954 CCCTTCTATTGGTCCACTGGGAC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 962927093 3:140004971-140004993 AAAACAAGTGCTGTTGCATTAGG 0: 1
1: 0
2: 1
3: 25
4: 228
962927088_962927093 17 Left 962927088 3:140004931-140004953 CCCCTTCTATTGGTCCACTGGGA 0: 1
1: 0
2: 1
3: 4
4: 109
Right 962927093 3:140004971-140004993 AAAACAAGTGCTGTTGCATTAGG 0: 1
1: 0
2: 1
3: 25
4: 228
962927092_962927093 -6 Left 962927092 3:140004954-140004976 CCACAGTTTATGATTCAAAAACA 0: 1
1: 0
2: 0
3: 23
4: 345
Right 962927093 3:140004971-140004993 AAAACAAGTGCTGTTGCATTAGG 0: 1
1: 0
2: 1
3: 25
4: 228
962927091_962927093 3 Left 962927091 3:140004945-140004967 CCACTGGGACCACAGTTTATGAT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 962927093 3:140004971-140004993 AAAACAAGTGCTGTTGCATTAGG 0: 1
1: 0
2: 1
3: 25
4: 228
962927090_962927093 15 Left 962927090 3:140004933-140004955 CCTTCTATTGGTCCACTGGGACC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 962927093 3:140004971-140004993 AAAACAAGTGCTGTTGCATTAGG 0: 1
1: 0
2: 1
3: 25
4: 228
962927084_962927093 29 Left 962927084 3:140004919-140004941 CCATATAATATGCCCCTTCTATT 0: 1
1: 0
2: 0
3: 19
4: 224
Right 962927093 3:140004971-140004993 AAAACAAGTGCTGTTGCATTAGG 0: 1
1: 0
2: 1
3: 25
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962927093 Original CRISPR AAAACAAGTGCTGTTGCATT AGG Intronic
901927381 1:12574969-12574991 TTTACAAGTGCTGCTGCATTTGG - Intronic
906919841 1:50051998-50052020 AATACCAGTCCTGTTGGATTAGG + Intronic
907364997 1:53950923-53950945 AAAAAAAATCCTGTTGCTTTTGG + Intronic
907789778 1:57651068-57651090 ATAAAAAGTGATGTTCCATTTGG + Intronic
911084256 1:93963397-93963419 AAACAAAGTGATGTTGAATTGGG + Intergenic
912358838 1:109077581-109077603 ATTACAAGTGATGTTGCTTTTGG - Intergenic
912881470 1:113420417-113420439 AAAACAAGGGCTGTAGATTTAGG + Intronic
913346395 1:117815260-117815282 AAACCAAGTGCTATTGCACTAGG + Intergenic
915186682 1:154111904-154111926 AAAAAAAGTGTTGTTGAATTTGG - Intronic
915441311 1:155947220-155947242 AAAACACGTGCAGTTGACTTTGG + Exonic
917731167 1:177876514-177876536 AAAACAAGTACTATTACATCTGG - Intergenic
918687347 1:187434265-187434287 AAAATAGGTTCTGTTGCTTTAGG - Intergenic
921239836 1:213167485-213167507 CACACAACAGCTGTTGCATTTGG + Intronic
921423731 1:214978385-214978407 AATAAAAGTGCTGCTCCATTAGG - Intergenic
923379148 1:233397396-233397418 ATAACAAGGCCTGTTACATTTGG + Intergenic
1063016117 10:2079434-2079456 AATACAAGTCCTATTGGATTAGG + Intergenic
1063038391 10:2312128-2312150 AAATTAGGTGCTGTTGGATTTGG + Intergenic
1065292964 10:24249416-24249438 AATACAAGTGCTGTAGGCTTGGG + Intronic
1065728272 10:28687749-28687771 AAAACAATTTTTGTTCCATTAGG - Intergenic
1065832539 10:29628240-29628262 AAATCAAGTGCTTTCCCATTTGG + Intronic
1068531524 10:58192730-58192752 AAAACAAGTAGGGTTGCCTTTGG - Exonic
1068545404 10:58338889-58338911 AAAACAACTAATGTTCCATTTGG - Intronic
1069410128 10:68144855-68144877 AAAACACCTGCTGATGCCTTTGG - Intronic
1071223737 10:83500941-83500963 AACACCAGTCCTATTGCATTAGG - Intergenic
1071229381 10:83566919-83566941 AAAAGAACTGATGATGCATTAGG + Intergenic
1071617448 10:87088143-87088165 AAATCATGTGTTGTTGCAGTAGG - Intronic
1073898981 10:108197120-108197142 AAGACAAGAAATGTTGCATTGGG + Intergenic
1076476545 10:130757685-130757707 AAAACCAGAGATGTGGCATTAGG - Intergenic
1078757002 11:14220737-14220759 AAAACAATTTCTTCTGCATTAGG + Intronic
1078874570 11:15379939-15379961 AAAATAAGCGCTATTGCATTAGG - Intergenic
1079951019 11:26804688-26804710 CAAGCAAGTACTATTGCATTTGG - Intergenic
1080104307 11:28495894-28495916 AAAGAAAGTGCTGCTGTATTTGG - Intergenic
1081163173 11:39776588-39776610 AAAAGAATTGGTGTTGCAATTGG + Intergenic
1082219264 11:49613704-49613726 GAAAAAAGGGCTATTGCATTAGG + Intergenic
1086539163 11:87886806-87886828 AAAACAAGTGCTTCAGCATCAGG - Intergenic
1086610589 11:88750409-88750431 AATCCAGGTGCTCTTGCATTGGG - Intronic
1088548824 11:110989488-110989510 AGAATAAGTAATGTTGCATTAGG - Intergenic
1090711930 11:129394618-129394640 AAAACATATGCTGTTAAATTGGG - Intronic
1094642820 12:32292668-32292690 AAAATAAGTCATGATGCATTTGG - Intronic
1096757179 12:53809453-53809475 AGAACCATTGCTGTAGCATTTGG + Intergenic
1096933759 12:55245528-55245550 AAAACAGCTGCAGTTGCCTTTGG + Intergenic
1098871610 12:75823162-75823184 AAAACCAGTGTTATGGCATTGGG - Intergenic
1099625446 12:85067222-85067244 ACAACAATTGCTGAGGCATTTGG - Intronic
1104469047 12:129014119-129014141 AAAAAAAGTGATGTTGGACTGGG + Intergenic
1105690511 13:22833350-22833372 AAAACAAGTGGGGTTGCCTTTGG - Intergenic
1105994352 13:25655973-25655995 ATAACAAGTGCAGTTGTATTTGG - Intronic
1107488576 13:40857356-40857378 AATACAATTGCTCTTGGATTTGG + Intergenic
1108174778 13:47781059-47781081 AAAACAACTTCTTTTGCATTAGG - Intergenic
1108628788 13:52260067-52260089 AATACAATTGCTCTTGGATTTGG + Intergenic
1108657267 13:52546386-52546408 AATACAATTGCTCTTGGATTTGG - Intergenic
1109730621 13:66408643-66408665 AAAATATGTGCATTTGCATTTGG - Intronic
1110773770 13:79381947-79381969 AAAACAACTGAATTTGCATTTGG + Intronic
1112536949 13:100268598-100268620 AAACCAAGAGATGTTGCATGCGG + Intronic
1113261639 13:108571360-108571382 AATACAAGTGGTGCTGAATTTGG + Intergenic
1119828508 14:77679209-77679231 AAAATAAGTGCTCTTGAATGTGG + Intronic
1120288744 14:82539522-82539544 AAAACAAATAGTGTTGAATTTGG - Intergenic
1120545136 14:85801762-85801784 AAATCAAGTACTCTTGAATTAGG + Intergenic
1120610299 14:86633550-86633572 GAAAAAAGTGCTTTTGCATTCGG - Intergenic
1121688850 14:95860079-95860101 AAAACAAGTGATGATGCCTTCGG + Intergenic
1123392340 15:19889221-19889243 TAAAAAATTGCTGTTTCATTTGG + Intergenic
1123494152 15:20807907-20807929 GAAATAAGTACTGGTGCATTTGG + Intergenic
1123550649 15:21376990-21377012 GAAATAAGTACTGGTGCATTTGG + Intergenic
1126077810 15:44930393-44930415 AAAATAAGTACAGTTGAATTTGG + Intergenic
1126080725 15:44958578-44958600 AAAATAAGTACAGTTGAATTTGG - Intronic
1126509095 15:49446624-49446646 AAAAAAGGTGCAGATGCATTAGG + Intronic
1127255105 15:57283681-57283703 ATATCAAGTGCAGTTTCATTTGG + Intronic
1127542791 15:59958972-59958994 AAAAATAGTGCTGGTACATTTGG + Intergenic
1131039598 15:89251399-89251421 AAAACAATTTATGTAGCATTAGG - Intronic
1202958990 15_KI270727v1_random:104243-104265 GAAATAAGTACTGGTGCATTTGG + Intergenic
1133916710 16:10115595-10115617 AATTCAGGTGCTGTTGCCTTGGG - Intronic
1134200908 16:12197899-12197921 AAAGAAAGTGCTGTTGCCGTGGG + Intronic
1137281371 16:46979602-46979624 AAAACAATTGCTGAGGCAGTGGG + Intergenic
1137694608 16:50453228-50453250 AAACTAAGTTCTGTTGCATTAGG - Intergenic
1139677784 16:68537096-68537118 AAAACAACTGCAGGTGCATAAGG - Intronic
1140303640 16:73782254-73782276 AATCCAAGTGCTGATACATTAGG + Intergenic
1143170408 17:4926351-4926373 AAAAAAATTTCTGTTGGATTAGG - Intergenic
1143531891 17:7510041-7510063 AAAACAGGTGGTGTTGAAATAGG + Intronic
1144718749 17:17453029-17453051 AAAATCAGTGCTGTTTGATTGGG + Intergenic
1147405405 17:40208220-40208242 AAAATAAGTGTTCTTGGATTTGG - Intergenic
1147881795 17:43659081-43659103 AAAAAGAGAGCTGGTGCATTTGG + Intronic
1149385847 17:56142704-56142726 AACACAGGTGCTGCTGCTTTGGG - Intronic
1150580158 17:66466077-66466099 AAAACAGCTGCTGGTGCACTTGG - Intronic
1153380523 18:4434165-4434187 AAAAAAAATGCTGTTGTATAGGG - Intronic
1153588545 18:6649103-6649125 AAAACAATTGCTCTTTTATTTGG + Intergenic
1153685874 18:7544786-7544808 AAAAAAAGTGCTGTGTTATTAGG - Intergenic
1154451681 18:14482368-14482390 GAAATAAGTACTGGTGCATTTGG + Intergenic
1157613047 18:48970596-48970618 AAAACAAGGGCTGTCCCACTGGG - Intergenic
1165809408 19:38601769-38601791 AAAACAAATGCTGATGATTTAGG - Intronic
925040083 2:725840-725862 AAAATCATTGCTGTTGCTTTGGG + Intergenic
927303650 2:21544720-21544742 AAGACCAGTGCTGTTGCTATAGG + Intergenic
928682773 2:33719642-33719664 AAAACAGGTGATGTGACATTTGG - Intergenic
929719024 2:44347359-44347381 AAAAGAAGCTCTGTTTCATTAGG - Intronic
929916447 2:46140477-46140499 AAAACAAGTGAAGTTGGATATGG + Intronic
931003824 2:57824696-57824718 AACACATATTCTGTTGCATTTGG - Intergenic
931201192 2:60098772-60098794 AAAAAAATTGCTGTACCATTGGG + Intergenic
933056973 2:77682813-77682835 AAAACAAGTTATTTTGTATTAGG - Intergenic
933927105 2:87103958-87103980 AAAACAAGTTATTTTGTATTAGG - Intergenic
936983026 2:118281453-118281475 TAGACATGTGCTATTGCATTGGG - Intergenic
939289287 2:140172650-140172672 AAAAGTAGTGCTGTGGAATTGGG - Intergenic
940626730 2:156184823-156184845 AGAACAAGTGCCTTGGCATTTGG + Intergenic
941548352 2:166883059-166883081 GAAACCAGTCCTGTTGAATTAGG + Intergenic
943779105 2:191801907-191801929 TAAACAAGTGATGCTGTATTTGG + Intergenic
944216893 2:197265209-197265231 AAAAAAAGTGCTGTTACTTAAGG - Intronic
944450511 2:199837258-199837280 AAAACAAGGGATTGTGCATTGGG - Intronic
944971751 2:205001428-205001450 GAAATAAATGCTGTTGTATTTGG - Intronic
945512598 2:210721208-210721230 GAAATAAGTGCTCTTCCATTAGG + Intergenic
946827227 2:223691185-223691207 AACACCAGTGCTATTGGATTAGG + Intergenic
1172365743 20:34347660-34347682 AAAAAAAGTGCTGTTCCATTTGG + Intergenic
1173034423 20:39395177-39395199 AAAAAAAATGTTGGTGCATTTGG + Intergenic
1174089848 20:48038132-48038154 AAATCAAGGGCTGTGGAATTGGG - Intergenic
1174126448 20:48310436-48310458 AAATCAAGGGCTGTGGAATTGGG + Intergenic
1175788912 20:61729420-61729442 AAAAAAAGTGCAGGTGTATTGGG - Intronic
1175866032 20:62177287-62177309 AAAAAAGGTGCTGAGGCATTGGG + Intronic
1176444465 21:6807855-6807877 GAAATAAGTACTGGTGCATTTGG - Intergenic
1176822630 21:13672893-13672915 GAAATAAGTACTGGTGCATTTGG - Intergenic
1177366683 21:20148806-20148828 AAAACAAATGCAGGTGAATTTGG + Intergenic
1178660163 21:34501028-34501050 AGAACAAGTCCTGTAGCTTTGGG - Intergenic
1179589275 21:42395323-42395345 AAAATAAGTCCTGTTGCACCAGG - Exonic
1180931918 22:19598131-19598153 AAAACAAGTGAACTTGCTTTGGG - Intergenic
1181891577 22:26068131-26068153 AAAACAATTTCTATTGCATGGGG + Intergenic
1182313027 22:29422754-29422776 AAAACATGTGCCGTTGGATAAGG + Intronic
1182943097 22:34297010-34297032 AAAACCAATGCTGTTGAATTAGG - Intergenic
1182964649 22:34509693-34509715 AAGAACATTGCTGTTGCATTGGG - Intergenic
1184065172 22:42114566-42114588 CAAACAATTGCTGTTTTATTTGG - Intergenic
1184181087 22:42826863-42826885 AAAATAAATCCTCTTGCATTTGG - Intronic
949353599 3:3152811-3152833 AAAACAAGTACTATTTCCTTTGG - Intronic
950998229 3:17528029-17528051 AAACCTAATACTGTTGCATTGGG - Intronic
951346456 3:21552168-21552190 AACAAAAGGGCTGTCGCATTGGG + Intronic
951510651 3:23498274-23498296 TAAACAAATGCTGTTGCAGATGG - Intronic
952290438 3:32010057-32010079 AATACAAGTCCTGTTAGATTAGG - Intronic
953070831 3:39517888-39517910 AAATCAATTTCTGTTGCATAAGG + Intronic
953763331 3:45711918-45711940 AACAAAACTGCTGTTGAATTTGG - Intronic
953892013 3:46757656-46757678 AACACAATTGCTATTGTATTAGG - Intronic
955398823 3:58576623-58576645 AAATCAAGAGCTGTAGGATTGGG - Intronic
957592793 3:82222889-82222911 AAAGCAAGTGCTTTTGAACTAGG - Intergenic
958454994 3:94319700-94319722 AAATCCAGTGCTGTGGCATTTGG + Intergenic
958599043 3:96269436-96269458 TAAACAAGTGATATTGGATTAGG + Intergenic
959783798 3:110268439-110268461 AAAGAATGTGCTGTTGCAGTAGG - Intergenic
959940350 3:112074761-112074783 ATATCAAGTGCTGTTTCTTTAGG + Intronic
960237472 3:115300453-115300475 AACACAAGTGCTCTTTCCTTTGG - Intergenic
960286893 3:115839672-115839694 AAACCAAATGCTGATGCATGTGG + Intronic
960661725 3:120067860-120067882 AAAACAAGGTCCGTAGCATTTGG - Intronic
960744187 3:120868438-120868460 AAAACAAGTGGTATTACAGTTGG + Intergenic
962059036 3:131905634-131905656 AAAACAGGTGCTGCTGCACTTGG + Intronic
962514956 3:136141690-136141712 AAAACATGTACAGTGGCATTAGG + Intronic
962927093 3:140004971-140004993 AAAACAAGTGCTGTTGCATTAGG + Intronic
963516325 3:146313711-146313733 AAAATAAGTCCTATTACATTTGG - Intergenic
966966178 3:184996751-184996773 AGGACAAGTGCTGTTGAATGAGG + Intronic
969568171 4:7992493-7992515 TAACCAAGGGCTGTTGCATTTGG - Intronic
971199484 4:24499129-24499151 CAAACAAATGCTGTTGAATTTGG + Intergenic
971991223 4:33897730-33897752 AATTCTAATGCTGTTGCATTAGG - Intergenic
977114953 4:93012215-93012237 AAAATAAGTGGTGTTCCAATTGG - Intronic
977566316 4:98584048-98584070 AAAACAAGCTCTGGTGCATTAGG - Intronic
978554492 4:109964285-109964307 AAAACAAGTACTGTAGAAATTGG + Intronic
981582716 4:146266593-146266615 AAAACAAGGGCTTTGGAATTTGG + Intronic
981649774 4:147043630-147043652 ACAACAAATGCTGTTGGAATAGG + Intergenic
981792505 4:148554643-148554665 AAAACAGTTGCTATTACATTAGG - Intergenic
981793285 4:148564804-148564826 AAAACCAGTCCTGCTGGATTTGG + Intergenic
982252679 4:153423204-153423226 AAAACAATTTATGTAGCATTGGG + Intergenic
982510130 4:156272053-156272075 AAAACAATTTCTGTTTCTTTGGG + Intergenic
983820364 4:172185352-172185374 AAAACAGGTGCTGCTGACTTTGG - Intronic
984824464 4:183912263-183912285 AACACAAGTGATTTTGCTTTAGG - Intronic
985188733 4:187347116-187347138 ATAACACGTGCTGTGGCAGTGGG - Intergenic
986359498 5:6962722-6962744 AAAACAAGACCTGTTGGAGTGGG + Intergenic
986544919 5:8885586-8885608 ATAATATGTGCTTTTGCATTTGG + Intergenic
986927991 5:12782150-12782172 AAAACCACTGCTATTTCATTGGG + Intergenic
988227934 5:28437721-28437743 AACACAAGTTCTGTTGACTTAGG + Intergenic
991151129 5:63372014-63372036 AAGACAAGTGCTGTTGATTTAGG + Intergenic
991566683 5:68012154-68012176 GAAACCAGTCCTGTTGGATTAGG + Intergenic
991680949 5:69138803-69138825 AAAACAACTTCTGTTCCTTTGGG + Intergenic
991955663 5:71993774-71993796 AGTACAAGTGCTTTTGCATACGG - Intergenic
995908537 5:117156581-117156603 ATAACAAGTTATTTTGCATTTGG + Intergenic
996609833 5:125365299-125365321 AAAACAAATGGTATTGCTTTTGG + Intergenic
997227744 5:132222084-132222106 AAAACTCAGGCTGTTGCATTTGG - Intronic
997440509 5:133905758-133905780 AAAACAAGTTCTGGTGCACATGG - Intergenic
997500244 5:134368164-134368186 AAATCAGGTGCTCTGGCATTGGG - Intronic
998663676 5:144270216-144270238 AATACATATGCTGTTGTATTTGG - Intronic
999030221 5:148282155-148282177 CAAACAGGTGCTGTCACATTGGG - Exonic
999668603 5:153938392-153938414 CAAACAATTGCTCTTGCCTTAGG + Intergenic
1006564178 6:34940189-34940211 AAAACAACTGCTGGTAAATTCGG + Intronic
1008277418 6:49557872-49557894 AAAACAAAAACTATTGCATTAGG - Intronic
1008735132 6:54533928-54533950 GAAACAAATACTCTTGCATTAGG + Intergenic
1009057890 6:58360078-58360100 AAAATAAATGCTTCTGCATTGGG - Intergenic
1009232943 6:61087013-61087035 AAAATAAATGCTTCTGCATTGGG + Intergenic
1010090515 6:71974900-71974922 AAAACAAGTGAAATAGCATTGGG + Intronic
1010258209 6:73784876-73784898 AGAACAGGGGCTGTTGGATTTGG + Intronic
1011268615 6:85552318-85552340 AAAATAAATGCTATTGAATTAGG - Intronic
1011667434 6:89648162-89648184 AAAATAACTCCTGTTGTATTTGG - Intronic
1013433210 6:110074747-110074769 AAAAAAAATACTGTAGCATTAGG - Intergenic
1015264362 6:131275820-131275842 ACAGCAAGTGCTGGCGCATTTGG - Intronic
1015904849 6:138106944-138106966 AAAGCTACTGCTGCTGCATTTGG + Intronic
1016431425 6:143989921-143989943 AAAACAAAAGCTGTTGGATAGGG + Intronic
1017310755 6:152974446-152974468 AAAACTATTTCTGTTGGATTAGG - Intronic
1017893872 6:158662301-158662323 AAAACAAGAGCTAATGCATAAGG + Intronic
1021025304 7:15659356-15659378 AAAACAAATGCTTTTGCAGTCGG + Intronic
1022437064 7:30397999-30398021 AAACCAAGTGCAATTGCCTTTGG - Intronic
1024357376 7:48427923-48427945 AAAACAAGGGATGTTGAATAAGG - Intronic
1024358618 7:48444506-48444528 AAAACAAGTGATGTGTCATAGGG - Intronic
1024510959 7:50204521-50204543 AAAGCAAATGCTCTTCCATTGGG + Intergenic
1026416372 7:70185218-70185240 AAAACCAGTGGTGTTGCTTTGGG + Intronic
1027668070 7:81064018-81064040 AAAAAATGTGCTGTTGGATGTGG + Intergenic
1029528831 7:101112029-101112051 AAAACAAGGGCTGTCTTATTTGG + Intergenic
1030369782 7:108685773-108685795 AACAAAAGTGCTGTTGCATGAGG - Intergenic
1030573484 7:111257026-111257048 AAAACTTGGGCTGTGGCATTTGG - Intronic
1030737857 7:113071022-113071044 AAAACAATTGCTGATGTGTTTGG + Intergenic
1030875366 7:114807064-114807086 AAAACAAGTTGTGTGGCCTTGGG - Intergenic
1032226431 7:130035512-130035534 AAAAAAAGTGCTGATATATTTGG - Intronic
1032539547 7:132691953-132691975 AAAACAAGTGCAGCTGCAAGAGG - Intronic
1033905866 7:146201603-146201625 AAAAAAAGTTCTGTTTCATTTGG - Intronic
1033957038 7:146862298-146862320 ATAAAAAGAGCTGTAGCATTTGG + Intronic
1035770613 8:2143721-2143743 AAGGCAAGTGCTGTGGCTTTGGG + Intronic
1036811845 8:11872491-11872513 TAAACAAGTGCTCTCGCAGTAGG - Intergenic
1037365701 8:18119826-18119848 AAATCCAGTGCTGTTTCTTTGGG + Intergenic
1038260839 8:25992573-25992595 TAAAGAAGTTCTGTTGCCTTTGG - Intronic
1038457851 8:27689568-27689590 GACACAAGTGCTGTTGTGTTTGG + Intergenic
1039507659 8:38063614-38063636 AAAACCACTGTTGTTGCAATTGG + Intergenic
1043119088 8:76299971-76299993 AAAACAAGTGCTACAGCCTTAGG - Intergenic
1043882383 8:85559601-85559623 AAAAGCAGTGCTTTTGCATGTGG - Intergenic
1044726466 8:95198336-95198358 AAAACAAGAGCTGTCGCTTTTGG - Intergenic
1045815738 8:106273721-106273743 AAAACAAGTGTTTTTGAATATGG - Intronic
1045917060 8:107484782-107484804 AAAGAAATTGCTGTTGCTTTCGG - Intronic
1046006976 8:108498576-108498598 CACACAACTGCAGTTGCATTTGG - Intergenic
1046189429 8:110772755-110772777 AAAACCAGTCCTATTGAATTAGG - Intergenic
1050104165 9:2148074-2148096 AACAGAAATGCTGTTGAATTTGG - Intronic
1051780305 9:20682637-20682659 AAAAGAAATACTGGTGCATTTGG + Intronic
1053080882 9:35175582-35175604 AAAACAAGGACAGTTTCATTTGG + Intronic
1054778413 9:69143628-69143650 AAAACAAGGGCTAAAGCATTTGG - Intronic
1056084309 9:83129800-83129822 AAAACCAGTGCTGTAGCCTTTGG - Intergenic
1056119744 9:83476042-83476064 AAAATAAGTGCTGTATCCTTGGG + Intronic
1056732017 9:89174560-89174582 AAAACCATTGCTTTTACATTGGG + Intronic
1057006013 9:91560624-91560646 AAAACATTTTTTGTTGCATTTGG + Intergenic
1057923538 9:99121023-99121045 AAAACAAGAGCTTGTGAATTTGG + Intronic
1058509293 9:105699243-105699265 AAAAGAAGTGGTGTTGGAGTAGG - Intronic
1058625860 9:106932150-106932172 ACAAGAAGTGCTGTTGAGTTTGG + Intronic
1059754055 9:117275854-117275876 GACACAAGTCCTGTTGGATTAGG + Intronic
1060083989 9:120680348-120680370 AAAACCAGTGTTACTGCATTTGG - Intronic
1060500830 9:124153211-124153233 AAAACAAGTCCTTTTGTATATGG - Intergenic
1061689581 9:132315233-132315255 AAAACAACAGCTGTTTCACTGGG + Intronic
1061772726 9:132938837-132938859 AAAACAAGTGCTGTGATATGTGG + Intronic
1203524733 Un_GL000213v1:76672-76694 GAAATAAGTACTGGTGCATTTGG + Intergenic
1186589185 X:10910868-10910890 AAATCAAGAGCTATTGCAATTGG - Intergenic
1188343789 X:29039013-29039035 AAAACAACTGCTGTTAAATTAGG - Intronic
1188874904 X:35417681-35417703 AAAATAAGTCATGTTGGATTTGG - Intergenic
1190991043 X:55550749-55550771 AAGATAAAAGCTGTTGCATTTGG - Intergenic
1193312613 X:80025575-80025597 AAAACACATGCTGTGGCATTAGG - Intronic
1193706016 X:84821190-84821212 AGAAGAAGTGCTGTTACCTTAGG - Intergenic
1196406151 X:115364801-115364823 ACAACAAGAGCTGTTGCACAAGG - Intergenic
1196539635 X:116892134-116892156 AAAACAAGTAGGGTTGCCTTTGG - Intergenic
1198215173 X:134549092-134549114 GAAAAAAGTGCTGTGGCGTTTGG - Intergenic
1198863790 X:141098377-141098399 AAAAAAACTGCTGATGCATGCGG - Intergenic
1198898898 X:141489038-141489060 AAAAAAACTGCTGATGCATGCGG + Intergenic
1199312845 X:146341567-146341589 CAAATAAGTGCTGTTGAATTAGG - Intergenic
1200075998 X:153551208-153551230 AAAATAAGTGCTGTTGAAGATGG - Intronic
1201552756 Y:15236019-15236041 AAATCAAATGCTGAAGCATTGGG - Intergenic
1202597393 Y:26555481-26555503 AATACAACTGCTCTTGGATTTGG - Intergenic