ID: 962927094

View in Genome Browser
Species Human (GRCh38)
Location 3:140004974-140004996
Sequence ACAAGTGCTGTTGCATTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962927090_962927094 18 Left 962927090 3:140004933-140004955 CCTTCTATTGGTCCACTGGGACC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 962927094 3:140004974-140004996 ACAAGTGCTGTTGCATTAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
962927088_962927094 20 Left 962927088 3:140004931-140004953 CCCCTTCTATTGGTCCACTGGGA 0: 1
1: 0
2: 1
3: 4
4: 109
Right 962927094 3:140004974-140004996 ACAAGTGCTGTTGCATTAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
962927092_962927094 -3 Left 962927092 3:140004954-140004976 CCACAGTTTATGATTCAAAAACA 0: 1
1: 0
2: 0
3: 23
4: 345
Right 962927094 3:140004974-140004996 ACAAGTGCTGTTGCATTAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
962927089_962927094 19 Left 962927089 3:140004932-140004954 CCCTTCTATTGGTCCACTGGGAC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 962927094 3:140004974-140004996 ACAAGTGCTGTTGCATTAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
962927091_962927094 6 Left 962927091 3:140004945-140004967 CCACTGGGACCACAGTTTATGAT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 962927094 3:140004974-140004996 ACAAGTGCTGTTGCATTAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962927094 Original CRISPR ACAAGTGCTGTTGCATTAGG TGG Intronic
906202468 1:43968864-43968886 TCAAGTGATGTTGCATGTGGGGG + Intergenic
910686899 1:89926830-89926852 ACATGTGCTTTGGCCTTAGGTGG + Intronic
918577472 1:186080015-186080037 TCAAGAGCTGAAGCATTAGGAGG - Intronic
1063698070 10:8356900-8356922 AAATGTGCAGTTGCATTAGGGGG - Intergenic
1063849367 10:10167370-10167392 ACAAATGCTGTTGATTTAAGTGG - Intergenic
1073253733 10:102137846-102137868 CCAGGTGCTGCTGCATGAGGAGG + Exonic
1073560342 10:104491059-104491081 ACAAGTGCACTTGTGTTAGGTGG - Intergenic
1076476544 10:130757682-130757704 ACCAGAGATGTGGCATTAGGAGG - Intergenic
1083066607 11:59930440-59930462 CCAACTGCTGTTGCCTCAGGAGG - Intergenic
1083811877 11:65110948-65110970 ACAAGGGCTGTGGGATTTGGAGG - Intronic
1090903106 11:131049855-131049877 ACAAGTGCATTTGCCTTATGTGG + Intergenic
1091723189 12:2827896-2827918 ACCAGGGCTGTTGCAGAAGGGGG + Intronic
1096016890 12:48284656-48284678 AAAATTACTGTTGCATTAGCAGG + Intergenic
1099459439 12:82904512-82904534 ACAAGTCCTGTCTCATTATGTGG + Intronic
1101434507 12:104653603-104653625 ACATGGGCTGTTGTATTATGGGG - Intronic
1102126719 12:110488565-110488587 AGAAGTGCTGTTGCTTGAGAAGG - Intronic
1104096671 12:125564671-125564693 GTAAGTGCTGGTGAATTAGGAGG - Intronic
1105690510 13:22833347-22833369 ACAAGTGGGGTTGCCTTTGGAGG - Intergenic
1106790247 13:33147984-33148006 ACAAATGCTGTTGCAACAAGTGG + Intronic
1106862446 13:33924185-33924207 ACAAGTGTAGATGTATTAGGTGG + Intronic
1107862383 13:44673098-44673120 ACAAGTGGTGTTGCTTTAGAGGG + Intergenic
1109468890 13:62778788-62778810 AAAAGTCTTGTTTCATTAGGAGG - Intergenic
1110700283 13:78539267-78539289 ACAAGTGCAGTTGTATTACATGG - Intergenic
1112830750 13:103447256-103447278 ACAAGAGTTGCTGAATTAGGAGG - Intergenic
1113937957 13:114005208-114005230 ACAAGTGCAGTTGTATTGGATGG - Intronic
1116344603 14:43775540-43775562 ACAACTGAGGTAGCATTAGGAGG + Intergenic
1119721349 14:76893009-76893031 AAAAATACTGTTGCATTACGAGG + Intergenic
1121688851 14:95860082-95860104 ACAAGTGATGATGCCTTCGGAGG + Intergenic
1126701396 15:51371145-51371167 AAAAGTTGTGTTGCATTATGTGG + Intronic
1128592044 15:68907602-68907624 ACAAGTGGTGTTGTATGATGAGG + Intronic
1130368940 15:83266737-83266759 CCAAGGGCTGTAGCATTGGGAGG + Intronic
1131900866 15:97086324-97086346 ACAATTGCTGTGGCAGTATGGGG - Intergenic
1132377352 15:101338364-101338386 ACAAGTGCTGCTGCTGTGGGGGG - Intronic
1133459110 16:5971566-5971588 ACAAGAGCTAGTGCATTAGCAGG - Intergenic
1144303993 17:13950712-13950734 ACAAGCGATGTTGCGTTGGGTGG - Intergenic
1147620117 17:41860782-41860804 ACAACTGCTGGTGGATTGGGTGG - Intronic
1153659283 18:7312332-7312354 ACATGAGATGTTGCATTTGGGGG + Intergenic
1153761807 18:8338964-8338986 ACAAGTGCAGTTGTGTTACGTGG + Intronic
1154042955 18:10876814-10876836 AGGAGGCCTGTTGCATTAGGTGG - Intronic
1158358016 18:56641731-56641753 ACAAGAGCTGTGGCCTTTGGTGG - Intronic
926496636 2:13596734-13596756 ACAAGTGGTGTTGCATGATTAGG + Intergenic
927442691 2:23130405-23130427 ACCAGTGCTGTTGAGGTAGGAGG + Intergenic
932259493 2:70315130-70315152 AGAAGGACTGTTGCATTAGGGGG + Intergenic
933443092 2:82339103-82339125 ACAAGTGGTTTTGCAGTATGTGG + Intergenic
941426761 2:165356365-165356387 ACAAGTGTTGTTACAATAGTTGG + Intronic
945319458 2:208405134-208405156 ATAAGTGATGTTGCATTAACTGG + Intronic
948548215 2:238747337-238747359 ACAAGTGCTGCTGCTTTACGGGG - Intergenic
948910749 2:241001299-241001321 AGAAGTGCTCTTGCATGAGATGG + Intronic
1169627354 20:7586849-7586871 GCAAGTGCCATTGCATCAGGTGG + Intergenic
1172448182 20:35003838-35003860 ACAGGTGTTGTTGCCTCAGGTGG - Intronic
1177677498 21:24320577-24320599 ACTAGTCCTGTTAGATTAGGGGG - Intergenic
1181025568 22:20125508-20125530 ACAAATGCTGTTGCCTTTTGGGG + Intronic
1182035821 22:27197459-27197481 ACAAGTGCTCTTACATGAAGAGG - Intergenic
956935864 3:74101308-74101330 ACAAGTGCTGGTGAACAAGGTGG - Intergenic
957622796 3:82616584-82616606 ACATGTGCTGGTGCTTTATGTGG - Intergenic
960367532 3:116791048-116791070 GGAAGTGCTGTTTCATCAGGTGG - Intronic
962927094 3:140004974-140004996 ACAAGTGCTGTTGCATTAGGTGG + Intronic
965717416 3:171621000-171621022 ACAAATGATGTAGCATCAGGTGG - Intronic
967428536 3:189355247-189355269 TAAAGTCCTGTTGCATCAGGCGG + Intergenic
969396846 4:6927275-6927297 ACAAGTGCTGTTACTGTGGGTGG + Intronic
970460350 4:16268896-16268918 ACCAGTGATGCTGCCTTAGGAGG - Intergenic
973040081 4:45458509-45458531 CCAAGAACTGTTTCATTAGGAGG + Intergenic
976068566 4:81216562-81216584 ACAAGTGCAGTCGCATTACACGG + Intergenic
977355367 4:95939733-95939755 ACAAGTGCAGTTGTATTACATGG + Intergenic
978948847 4:114531947-114531969 TAATGTGCTGTTGAATTAGGTGG - Intergenic
982150351 4:152448116-152448138 ATAAGTGCTGCTGCTTTAAGTGG + Intronic
982237108 4:153261869-153261891 TCAAGTTCTTTTGCATTTGGGGG + Intronic
986475856 5:8131499-8131521 ACAAGTGTTGTTACTTTAAGAGG - Intergenic
989743150 5:44795457-44795479 ACAATTACTGTTGAATTAGATGG + Intergenic
991468023 5:66935567-66935589 ACAAGTGCTTTGGCAATAAGTGG - Intronic
992613685 5:78529887-78529909 ACAAGTGCTGTTGGAAGAGTTGG - Intronic
994223711 5:97227663-97227685 ACAAGTGCTTTTTCAGTATGTGG + Intergenic
994226147 5:97253786-97253808 ACAAGGGCTCTTTAATTAGGAGG - Intergenic
996404468 5:123091511-123091533 ACAAGTACAGTTCCATTTGGCGG + Intronic
998421876 5:141994992-141995014 ACAAGTGCTGTTTCAGTGGAGGG + Intronic
1001324964 5:170716737-170716759 ACAAGTGCTGTTTCTTGAGTCGG + Intronic
1007338620 6:41173726-41173748 ACCAGTGCTGTTCCATTAGTGGG - Intergenic
1009669848 6:66733017-66733039 ACAATTTCTGTTGAATTATGGGG + Intergenic
1012169074 6:95995916-95995938 AGGAGTGCTGTTGGTTTAGGTGG - Intergenic
1013584447 6:111566006-111566028 ACACCTGCTGTTGCATCATGTGG - Intronic
1014938208 6:127408803-127408825 AGAAGTGCTGTTGAATTGTGTGG + Intergenic
1023324896 7:39043472-39043494 GCAAGTGCTGTTGCAGTAATGGG + Intronic
1025965057 7:66262111-66262133 ATAAGTGCTGTTGCAGTCTGTGG + Intronic
1027820123 7:83032314-83032336 CCTTGTGCTGTTGCATTAGAAGG - Intronic
1029320380 7:99753463-99753485 ACAAGACCAGTTGCATTAGTTGG - Intergenic
1031338629 7:120570371-120570393 AAAAGTGCAGTTGTATTACGTGG - Intronic
1034783764 7:153906228-153906250 ACAAGTGCAGTTGTGTTACGCGG + Intronic
1038932223 8:32206668-32206690 ACAAGTGCAGTTTCATTACATGG + Intronic
1042198544 8:66256278-66256300 ACTAGTGCTATTGCATAATGTGG - Intergenic
1042274729 8:66992501-66992523 AAACGTGCTGATGCATTATGGGG - Intronic
1045016872 8:98007970-98007992 ACACATGCTGTTGCATTCAGGGG + Intronic
1046699534 8:117384264-117384286 ACAAATGCTGTCAAATTAGGTGG - Intergenic
1049322535 8:142004490-142004512 AGAAGGGCTGTTGCTTTTGGCGG - Intergenic
1050221430 9:3395003-3395025 GAAAGTGCCTTTGCATTAGGTGG - Intronic
1051369457 9:16345809-16345831 AAAAGTGCTAATGCTTTAGGAGG + Intergenic
1052561798 9:30092751-30092773 TCAACTGCTCTTGCATGAGGTGG - Intergenic
1052658516 9:31397681-31397703 GAAAGTGCTGTTGCTTTACGTGG + Intergenic
1054833868 9:69655816-69655838 ATAAGTTCTGTTACATTAGCAGG + Intronic
1056382296 9:86066165-86066187 ACAAATGCTGTTGTATTTGAGGG + Intronic
1058100540 9:100914244-100914266 GGAAGAGCTGTTGCAGTAGGTGG + Intergenic
1058509292 9:105699240-105699262 AGAAGTGGTGTTGGAGTAGGAGG - Intronic
1059044834 9:110855166-110855188 AAAAGTGCTGATGAATAAGGAGG - Intergenic
1060938151 9:127527691-127527713 ACCAGTGCTGTAGCTGTAGGTGG - Intronic
1186719883 X:12291906-12291928 ACAAGTGCTGTTTCTTTTGTAGG - Intronic
1187212282 X:17243351-17243373 ACACCTGCTGATGAATTAGGTGG + Intergenic
1190991042 X:55550746-55550768 ATAAAAGCTGTTGCATTTGGAGG - Intergenic
1195217006 X:102712553-102712575 GCAAGTGCGGGTGCATGAGGTGG + Intronic
1195564990 X:106330358-106330380 AGAAGTGCTGAGGCATGAGGGGG - Intergenic
1196742431 X:119037044-119037066 ACAAATGCAGTTTCATTATGTGG + Intergenic
1198215170 X:134549089-134549111 AAAAGTGCTGTGGCGTTTGGGGG - Intergenic