ID: 962927888

View in Genome Browser
Species Human (GRCh38)
Location 3:140011931-140011953
Sequence GAACCCTCTGGGAGACCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962927877_962927888 25 Left 962927877 3:140011883-140011905 CCCAGATCTGGGGTGCCGAATGG 0: 1
1: 0
2: 0
3: 3
4: 75
Right 962927888 3:140011931-140011953 GAACCCTCTGGGAGACCTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 163
962927876_962927888 26 Left 962927876 3:140011882-140011904 CCCCAGATCTGGGGTGCCGAATG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 962927888 3:140011931-140011953 GAACCCTCTGGGAGACCTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 163
962927882_962927888 1 Left 962927882 3:140011907-140011929 CCTAGTCAGGAAATTGAGACCAG 0: 1
1: 1
2: 49
3: 463
4: 1525
Right 962927888 3:140011931-140011953 GAACCCTCTGGGAGACCTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 163
962927881_962927888 10 Left 962927881 3:140011898-140011920 CCGAATGGTCCTAGTCAGGAAAT 0: 1
1: 0
2: 2
3: 6
4: 91
Right 962927888 3:140011931-140011953 GAACCCTCTGGGAGACCTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 163
962927879_962927888 24 Left 962927879 3:140011884-140011906 CCAGATCTGGGGTGCCGAATGGT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 962927888 3:140011931-140011953 GAACCCTCTGGGAGACCTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962927888 Original CRISPR GAACCCTCTGGGAGACCTGA AGG Intronic
900589332 1:3452805-3452827 GAACCAGCTTGGAGACCTAAGGG - Intergenic
901343808 1:8520338-8520360 GGACCCTGTGGGAGAGCTGCCGG - Intronic
902273820 1:15325363-15325385 GAACCCAGTGGGAGACATGGGGG - Intronic
903857607 1:26346006-26346028 GCACCATGCGGGAGACCTGACGG + Exonic
904403125 1:30269863-30269885 GAATCCTCTGGAAGTCCTGGGGG + Intergenic
907021434 1:51070137-51070159 CTACCATCTGGGAGGCCTGATGG - Intergenic
907841273 1:58160079-58160101 GCAGCCTCTGTGAGACCTAATGG + Intronic
909609692 1:77539425-77539447 AGACTCTCTGGGAGTCCTGAAGG - Intronic
912693772 1:111824678-111824700 ATACTCTCTGGGAGGCCTGAGGG - Intronic
913235564 1:116778445-116778467 GAACCCTCTGAGAAGACTGAAGG - Intergenic
914234582 1:145797018-145797040 ATATCATCTGGGAGACCTGATGG - Intronic
916275486 1:162989085-162989107 GAACCCTCTGAGGCACCTGGTGG + Intergenic
917876174 1:179289124-179289146 GAACCATCCAGGAGACATGAAGG - Intergenic
917969886 1:180199752-180199774 GAGGCTTCTGCGAGACCTGAAGG + Exonic
918680871 1:187351340-187351362 AAACCCAGTGGGAGAGCTGATGG - Intergenic
920519804 1:206614812-206614834 GAACAGTCTGGGAGCCCTGTGGG - Intergenic
921796090 1:219346366-219346388 ATACCGTCTGGGAGAACTGAGGG + Intergenic
922788817 1:228298401-228298423 AAACCCTCTGGAGGATCTGAGGG - Intronic
1063618391 10:7622186-7622208 GAGCCCCCTGGGAGTCCTGGTGG - Intronic
1065128433 10:22596661-22596683 GACCCCTCGGGGGCACCTGAAGG - Intronic
1070717832 10:78735284-78735306 GGAACCTCTGTGAGACCTGTTGG + Intergenic
1071671499 10:87613147-87613169 GAGGCCTCTGGGTGACCTCAAGG + Intergenic
1072300322 10:94054567-94054589 GAAGCCTCTGGGAGAGTTCAGGG + Intronic
1073569307 10:104563114-104563136 GAGCCCTCTGTGTGACATGAGGG - Intergenic
1074543632 10:114385941-114385963 GAATCCTCAGGGACTCCTGAGGG - Intronic
1075882965 10:125870308-125870330 GAAATCTCTGGAAGACATGAAGG + Intronic
1076813000 10:132898843-132898865 GCACCCTCTGGGAGGCCTGTGGG + Intronic
1078516454 11:12026831-12026853 GATACATCTGGGAGCCCTGATGG + Intergenic
1079724928 11:23868936-23868958 CTACTTTCTGGGAGACCTGATGG - Intergenic
1080663116 11:34313453-34313475 GCACTCTCTGGGGGGCCTGATGG - Intronic
1084134982 11:67171253-67171275 GAACACTGAGGGAGACCTGATGG - Intronic
1084720816 11:70904487-70904509 GGACCCGGTGGGAGATCTGATGG + Intronic
1087830115 11:102810435-102810457 GAAGACACTGGGGGACCTGATGG - Intergenic
1091299406 11:134497937-134497959 GAAGCCACTGGGAGGCTTGAAGG + Intergenic
1091601034 12:1917934-1917956 GCAGCTTCTGGGACACCTGAAGG - Intronic
1094436790 12:30429831-30429853 ATACTATCTGGGAGACCTGATGG - Intergenic
1096469208 12:51865642-51865664 CAACCCTCTTGGAGTCCTGATGG - Intergenic
1100309718 12:93383011-93383033 AAACCTTCTGGGAGAGCTGGAGG - Intronic
1101842559 12:108339045-108339067 GAACCCTCAGGAAGACCTTCCGG - Exonic
1102714731 12:114960442-114960464 GCATCCTCTGGGAGACCAGTTGG - Intergenic
1103494489 12:121351121-121351143 CAATACTCTGGGAGACCAGACGG + Intronic
1104126063 12:125847405-125847427 ATACTCTCTGGGAGGCCTGATGG - Intergenic
1104328642 12:127823945-127823967 ATACTCTCTGGGAGGCCTGATGG - Intergenic
1105866742 13:24467675-24467697 ATACATTCTGGGAGACCTGAAGG + Intronic
1112478867 13:99755713-99755735 TCACCCTCTGGGAGACTTCATGG - Intronic
1113020167 13:105876173-105876195 GAAGCCTCTTGGAGATCTAATGG - Intergenic
1113071492 13:106425826-106425848 GAAACAGCTGGGCGACCTGAAGG + Intergenic
1113452644 13:110422553-110422575 GACCCCTCTGGGACACGTGGAGG + Intronic
1114302815 14:21393620-21393642 GAACACTCCGGGAAACCAGAGGG + Exonic
1118732122 14:68675750-68675772 TAACCCTCTCGGAGCTCTGAAGG - Intronic
1118879005 14:69810383-69810405 GAGCCCTCTGATAGACCTGTGGG - Intergenic
1120720773 14:87887895-87887917 GATTCCTTTGGGAGGCCTGAAGG - Intronic
1120825570 14:88951753-88951775 ATACTATCTGGGAGACCTGATGG + Intergenic
1121789813 14:96690545-96690567 GAAATCTCTGCAAGACCTGAAGG - Intergenic
1122847707 14:104509916-104509938 GAGCCCTCTGGGAGGCATGCGGG - Intronic
1122921668 14:104882860-104882882 CCACCCTCTGGGAGCCCTCAGGG - Intronic
1123106102 14:105841732-105841754 GAGCCCTCTGAGGGGCCTGAGGG + Intergenic
1124486286 15:30120019-30120041 TAACTATCTGGGAGGCCTGATGG + Intergenic
1124541361 15:30589004-30589026 TAACTATCTGGGAGGCCTGATGG + Intergenic
1124757297 15:32418583-32418605 TAACTATCTGGGAGGCCTGATGG - Intergenic
1125132100 15:36294698-36294720 GGACCCTCTGAGAAACCTAAAGG + Intergenic
1125723992 15:41858886-41858908 GAACCTCCTGGGAGTCCTGCAGG + Exonic
1127876916 15:63119637-63119659 ATACTATCTGGGAGACCTGATGG - Intergenic
1129243934 15:74268540-74268562 GCCCCCTCTGGCTGACCTGAGGG + Intronic
1129974782 15:79813061-79813083 CCACACTCTGGGAGATCTGATGG + Intergenic
1134557170 16:15175325-15175347 GAACCCTCAGGCACAGCTGATGG + Intergenic
1134888461 16:17816578-17816600 ATACTATCTGGGAGACCTGATGG + Intergenic
1138590126 16:57995248-57995270 GAAGCCTGTGGGGGACCTGGTGG - Exonic
1138760131 16:59533522-59533544 GAAGCCTCTGGGAAACATGCAGG - Intergenic
1139631662 16:68235317-68235339 GACGCCTTTGGGAGACCTGCTGG - Intronic
1141481629 16:84310299-84310321 GGTCCCTCTGGAAGACCTGAAGG + Intronic
1142023107 16:87796232-87796254 GAAACATCTGGCAGATCTGATGG - Intergenic
1142661803 17:1435542-1435564 GAACTCACAGGAAGACCTGAGGG + Intronic
1142864290 17:2780980-2781002 GAACCATCTGGAATCCCTGAAGG - Intronic
1143561178 17:7696116-7696138 GAAGCATCTAAGAGACCTGAAGG + Intronic
1144651362 17:17009246-17009268 GAACCCTTGGGGAGACCAGCTGG - Intergenic
1146160352 17:30556210-30556232 GAAGCCTCCTGGTGACCTGAAGG + Intergenic
1147385004 17:40075800-40075822 CAACCCTCTGGGAGGCGTGAGGG + Intronic
1147733911 17:42622064-42622086 GAAAACTATGGGAGACATGAGGG + Intergenic
1147882466 17:43662911-43662933 TAACCCTCTGAGAGACCAGCAGG - Intergenic
1151286934 17:73118960-73118982 GAACCAGCTGGGTGACCTGCAGG + Intergenic
1153719563 18:7888123-7888145 AATGCCTCTGGGAGACCTGAGGG + Exonic
1153738621 18:8099259-8099281 GAGCTCTCTGGGAGAGCTGCAGG - Intronic
1154253958 18:12767032-12767054 CAAACCTGTGGGAGATCTGAGGG + Intergenic
1155218197 18:23662059-23662081 CAACCCTGGGGGAGACCTGTGGG - Intronic
1155325971 18:24665289-24665311 CAACCCTGTGGGGAACCTGATGG + Intergenic
1157718330 18:49904737-49904759 GGACCCTCTGGTAGGCCTGGCGG + Exonic
1157922018 18:51722970-51722992 GAACCTTCTGAAACACCTGATGG + Intergenic
1161008880 19:1950583-1950605 GAGGCCTCTGGGAGACAGGAGGG + Intronic
1162106633 19:8373795-8373817 GAATCTTCTGGAAGACCTGGCGG + Exonic
1164883636 19:31758980-31759002 GAACCCCCTGGGAGATTTGGGGG - Intergenic
1165279669 19:34785445-34785467 GAATGTTCTGGGAGCCCTGAAGG - Intergenic
1168317813 19:55491652-55491674 GGACCCCCTGGGAGACATGAGGG - Intronic
928247025 2:29639277-29639299 GAACCCTCTGGAACAGCTTACGG - Intronic
932400121 2:71474666-71474688 GGACCCTCTGGGTAACATGAAGG - Intronic
934673539 2:96232626-96232648 GAACCTTCTGGGGGGCCTAACGG - Intergenic
934870929 2:97864706-97864728 GAAGCCCTTGGGAGAACTGAAGG + Intronic
935713509 2:105919499-105919521 CTACCCTCTGGGATCCCTGAAGG - Intergenic
943551041 2:189339819-189339841 GAACTATTTGGGAGGCCTGATGG + Intergenic
943611320 2:190038316-190038338 GCACCCTCTTGGATACCTGGTGG + Intronic
944931657 2:204526386-204526408 GAACTGACTGGGTGACCTGAAGG - Intergenic
946002894 2:216497959-216497981 GACCCCTTTGAGAGACCTGGAGG + Intergenic
946938077 2:224742560-224742582 GTACTATCTGGGAGGCCTGATGG - Intergenic
948822570 2:240557521-240557543 GAGTCCTCAGGGAGACCTGTCGG + Intronic
1168863316 20:1062084-1062106 GAACCTTCTGTGAGACTTTAGGG - Intergenic
1168949079 20:1784239-1784261 GAACCCACAGGGAGACATTAGGG - Intergenic
1170262778 20:14429860-14429882 GGACCCTCTGGTAAACATGAAGG - Intronic
1176056227 20:63150666-63150688 GATCCCACTGGGAGACCTGGTGG - Intergenic
1179336694 21:40463457-40463479 GAACACACTGGAAGAACTGATGG - Intronic
1181671461 22:24427398-24427420 GGACCCTGTGGGAGGCTTGAAGG - Intronic
1184688059 22:46105243-46105265 GGACCCTGTGGGAGCCCTGTGGG + Intronic
1184688063 22:46105254-46105276 GAGCCCTGTGGGAGCCCTGTGGG + Intronic
949305481 3:2635833-2635855 AAACTATCTGGGAGACCTGATGG - Intronic
953312492 3:41892703-41892725 TAACTATCTGGGAGGCCTGATGG - Intronic
953537942 3:43790113-43790135 GGACCCTCTGGGAGACTGCAGGG + Intergenic
953743508 3:45556196-45556218 CAACCCTCTAGGTGACCTGGTGG - Intronic
959504401 3:107141906-107141928 ATACCATCTGGGAGGCCTGAGGG + Intergenic
962825068 3:139093991-139094013 GAACTCCCTGGGAGAGCTGAAGG + Intronic
962927888 3:140011931-140011953 GAACCCTCTGGGAGACCTGAAGG + Intronic
963005216 3:140720824-140720846 GAACCCTGTGGGAGGATTGATGG + Intergenic
963043191 3:141083907-141083929 GAACCCTCTGGAGGCCCTGCAGG + Intronic
964281472 3:155071223-155071245 TAATCATCTGGGAGACATGAGGG + Intronic
965866165 3:173206422-173206444 GAATATTCTGGGAGAACTGATGG + Intergenic
968130487 3:196190200-196190222 GAAGCCTCTGGAAGGCCTCAAGG - Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968592012 4:1464046-1464068 GAAGGCCCTGGGAGACCCGAGGG + Intergenic
970889872 4:21031079-21031101 GGACCCTCTTGGAGACCAGATGG - Intronic
971995179 4:33955594-33955616 GAACCCTCATGGAGCCCAGAAGG - Intergenic
974070599 4:57119792-57119814 GAGACCTCTGTGAGACCTGAAGG - Intergenic
977696149 4:99968775-99968797 GAACCATTTGGGAGGCCTGATGG - Intergenic
977848216 4:101791093-101791115 GAACCCTCTGGGCTGCCTGGCGG - Intronic
978171606 4:105677802-105677824 GAACTCTCTGGTATTCCTGAAGG - Exonic
978629897 4:110732302-110732324 GACCCCACTGGGACATCTGAAGG - Intergenic
981527838 4:145724194-145724216 TAAGCCTCTGGGAGGCCTGTGGG + Intronic
982158151 4:152540957-152540979 GCACCCTCTGGGGGACGGGAAGG - Intergenic
984784715 4:183556897-183556919 GAAACCTCTGGAAGATTTGATGG + Intergenic
989463284 5:41725801-41725823 GACCCCTCTTTGAGGCCTGATGG + Intergenic
989609467 5:43277400-43277422 AAGCCCTCTGGGACACTTGAGGG - Intronic
989811958 5:45688226-45688248 AAACCTTCTGGGAAACGTGATGG - Intronic
990965957 5:61448049-61448071 AGACTTTCTGGGAGACCTGATGG + Intronic
991975138 5:72177709-72177731 CAAGCTTCTGGGAGACCTGTTGG + Intronic
994341439 5:98633391-98633413 GAACACAGTGGGAGACCTTAGGG - Intergenic
997628725 5:135350027-135350049 GAACACACTGAGGGACCTGAGGG - Intronic
998896645 5:146807048-146807070 GGAGCCTTTGGGAGACCTGGGGG + Intronic
1001199733 5:169705270-169705292 AAGCCCTCTGAGGGACCTGAGGG + Intronic
1003043384 6:2710425-2710447 ATACTGTCTGGGAGACCTGATGG - Intronic
1003195635 6:3911761-3911783 GGACCCTCCAGGAGAACTGATGG - Intergenic
1003494385 6:6651534-6651556 GAACTCTCTGGGAGAGTTTAGGG - Intronic
1005034029 6:21538974-21538996 GAACCCTCTGGGTTACATTAAGG - Intergenic
1007150726 6:39688224-39688246 GACCCCACTGGGAGGCCAGAGGG + Intronic
1017200020 6:151742890-151742912 CAACCATCTGTGAGACCTGAAGG - Intronic
1018173417 6:161159875-161159897 CAGCACTTTGGGAGACCTGAAGG - Intronic
1018523000 6:164673287-164673309 AAACTCTCTGGGAGGCCTGATGG + Intergenic
1020771270 7:12398335-12398357 ATACCATCTGGGAGGCCTGATGG - Intronic
1023310394 7:38880552-38880574 GAAACCTCTGAGAGAGCTTAAGG - Intronic
1023622365 7:42086697-42086719 GAGCCCCCTGGGAAGCCTGATGG - Intronic
1024326002 7:48109679-48109701 GAACCCTCAAGGAGACTTCAGGG + Intergenic
1026571348 7:71534032-71534054 ATACCGTCTGGGAGGCCTGATGG + Intronic
1026722161 7:72841301-72841323 ATACCATCTGGGAGGCCTGATGG + Intergenic
1028740946 7:94274227-94274249 ATACTGTCTGGGAGACCTGAGGG + Intergenic
1034219968 7:149436517-149436539 GGGCCCTCTGGGAGGCCTCATGG + Intronic
1035839397 8:2794652-2794674 GAACTTCCTGGGAAACCTGAGGG - Intergenic
1037697020 8:21232367-21232389 GAATCTTCAGGGAGACCTCAAGG - Intergenic
1038662100 8:29506288-29506310 ATACTCTCTGGGAGAACTGATGG - Intergenic
1039911863 8:41832684-41832706 GAACCCTCTGGGAACCCTGGGGG - Intronic
1040668991 8:49664122-49664144 ATACAATCTGGGAGACCTGATGG + Intergenic
1044962073 8:97541115-97541137 AAAGCCACTGGGAGACCAGATGG + Intergenic
1045495408 8:102703896-102703918 GTACCATCTGGGAGGCTTGATGG - Intergenic
1045499792 8:102736520-102736542 GTACTGTCTGGGAGGCCTGATGG - Intergenic
1045520234 8:102896935-102896957 GAACACCCCGGGAGACCTGTGGG + Intronic
1046151141 8:110228024-110228046 ATACTCTCTGGGAGGCCTGATGG - Intergenic
1049231069 8:141481863-141481885 GGACCTTCTGGGGGACCTCAGGG - Intergenic
1050457379 9:5846961-5846983 CACCCCTGTGGGAAACCTGAAGG - Intergenic
1060199611 9:121645044-121645066 GCACCCACTGGGAAACCAGAGGG - Intronic
1062345384 9:136112079-136112101 GAGCCCTGTGGGGGATCTGAGGG - Intergenic
1186765080 X:12762589-12762611 GAGCCTTCTGGGAGACCTACAGG - Intergenic
1189215643 X:39320789-39320811 GAACCCTCTGAGAAACCAGGTGG + Intergenic
1189971040 X:46418562-46418584 GAACCCTCTGGCAAATCTGGGGG + Intergenic
1196172259 X:112602474-112602496 GGACCTTCTGAGAAACCTGAAGG + Intergenic
1199788736 X:151129952-151129974 GAACTATCTGGGAGGCCTGAGGG + Intergenic
1199789415 X:151138005-151138027 GAACTATCTGGGAGGCCCGAGGG + Intergenic