ID: 962928107

View in Genome Browser
Species Human (GRCh38)
Location 3:140013400-140013422
Sequence CTTGTTCCGGCTCTTTGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962928101_962928107 24 Left 962928101 3:140013353-140013375 CCACATGTGGTGACAGCAGAGCT 0: 1
1: 0
2: 2
3: 19
4: 191
Right 962928107 3:140013400-140013422 CTTGTTCCGGCTCTTTGTTTTGG 0: 1
1: 0
2: 0
3: 10
4: 138
962928100_962928107 28 Left 962928100 3:140013349-140013371 CCAGCCACATGTGGTGACAGCAG 0: 1
1: 0
2: 2
3: 17
4: 213
Right 962928107 3:140013400-140013422 CTTGTTCCGGCTCTTTGTTTTGG 0: 1
1: 0
2: 0
3: 10
4: 138
962928099_962928107 29 Left 962928099 3:140013348-140013370 CCCAGCCACATGTGGTGACAGCA 0: 1
1: 0
2: 0
3: 10
4: 160
Right 962928107 3:140013400-140013422 CTTGTTCCGGCTCTTTGTTTTGG 0: 1
1: 0
2: 0
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962928107 Original CRISPR CTTGTTCCGGCTCTTTGTTT TGG Intronic
900297019 1:1957060-1957082 CGTGTCCAGGCTCCTTGTTTAGG - Intronic
901448294 1:9321148-9321170 CTTTTTCCAGCTTTGTGTTTTGG - Intronic
903391132 1:22964303-22964325 TTTGTTCCGCCTCATTCTTTTGG - Intronic
903595500 1:24490737-24490759 CTTGTTACTGCTCACTGTTTGGG + Intergenic
905770661 1:40636074-40636096 CTTGTTCCCTCTCTGTGCTTGGG - Intronic
906734397 1:48110687-48110709 CTGGTTCCTTCTCTTTGTTCAGG - Intergenic
909815285 1:79984932-79984954 TTTGTTCGGGCTCTCTGTTAAGG - Intergenic
910762627 1:90749507-90749529 TTGTTTCCGGCTCTTTGTCTTGG + Intergenic
911487577 1:98521411-98521433 CTTCTTCAGGTTTTTTGTTTTGG - Intergenic
912275025 1:108247257-108247279 CTTGTTCTGCTTCTGTGTTTGGG + Intergenic
912293197 1:108447094-108447116 CTTGTTCTGCTTCTGTGTTTGGG - Intronic
913387039 1:118269608-118269630 CCTGCACCGGCTCATTGTTTAGG - Intergenic
914822804 1:151118034-151118056 CTGCTTCCTGCTCTTTCTTTAGG - Exonic
915336485 1:155145855-155145877 ATTGCTCTGGGTCTTTGTTTTGG - Intergenic
917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG + Intronic
919702824 1:200648899-200648921 CTTGCTCAGGCTTTTTGTTTGGG - Intronic
920150371 1:203901113-203901135 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
921457887 1:215394332-215394354 CTTGTTGCTGCTCAGTGTTTGGG - Intergenic
923591763 1:235327060-235327082 CTGGTTGCGGCTCTTTCTTCGGG - Intronic
1065641014 10:27782916-27782938 GTTGTTCCGGATCTTTGATGAGG + Intergenic
1066693661 10:38058792-38058814 CTGGTCCTGGCACTTTGTTTTGG - Exonic
1068133672 10:52927630-52927652 CTGGTTCTGGGTCTTTGCTTTGG - Intergenic
1069096050 10:64261324-64261346 CTTTTTCCAGCCCTATGTTTAGG + Intergenic
1070648751 10:78219966-78219988 CTTTCTGCTGCTCTTTGTTTGGG + Intergenic
1070942440 10:80358978-80359000 CTTGCTGCTGCTCATTGTTTGGG - Intronic
1071054253 10:81490758-81490780 CTTGTTGCTGCTCATTCTTTGGG + Intergenic
1071054258 10:81490830-81490852 CTTGTTGCTGCTCATTTTTTGGG + Intergenic
1071278567 10:84078586-84078608 CTTCTACTAGCTCTTTGTTTAGG - Intergenic
1072088314 10:92101993-92102015 ATTGTTGTGGCTCTTAGTTTTGG - Intronic
1073193900 10:101672542-101672564 CTTTTGCCTGCTCTCTGTTTAGG - Intronic
1077603373 11:3589587-3589609 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
1080328686 11:31109747-31109769 CATGCTCAGGCTCTTTATTTTGG - Intronic
1080822590 11:35821590-35821612 CTAGTCCCGGCTCCTTGTCTTGG + Intergenic
1081241642 11:40713809-40713831 CTTCTACAGTCTCTTTGTTTGGG - Intronic
1084259271 11:67964132-67964154 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
1084599371 11:70135846-70135868 CCTGTTGCGGCTCTTGTTTTGGG + Intronic
1084813502 11:71631049-71631071 CTTGTTGCTGCTCACTGTTTGGG - Intergenic
1086508158 11:87527792-87527814 CTTGTTCCGCCCATTTGTTCAGG + Intergenic
1088400718 11:109420832-109420854 CTTCTTCGGACTCTGTGTTTAGG - Intergenic
1090442694 11:126737326-126737348 CTTGTGCCGTCTCTGTGCTTTGG - Intronic
1098456643 12:70681682-70681704 GTTGTTTTGGCTCTTTTTTTTGG + Intronic
1098632823 12:72745228-72745250 CTTCTTCCTTCTTTTTGTTTAGG - Intergenic
1101645834 12:106630122-106630144 CTTTTTCCTGCTATTTTTTTGGG + Intronic
1102655573 12:114480067-114480089 TTTGATCCCGCTCTTTTTTTGGG + Intergenic
1103691875 12:122781776-122781798 GTTATCCCAGCTCTTTGTTTGGG + Intronic
1105832970 13:24182082-24182104 CTTGTTTGGGGTATTTGTTTTGG + Intronic
1107293155 13:38880411-38880433 CTTCTTCCGGCTCTTGGTGGTGG - Exonic
1109138873 13:58688197-58688219 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
1109749257 13:66668181-66668203 ATTTTTCTGTCTCTTTGTTTAGG + Intronic
1110931727 13:81226900-81226922 CTTGTTGCTGCTCACTGTTTGGG - Intergenic
1112226656 13:97546195-97546217 CTTGCTACTGCTCATTGTTTGGG + Intergenic
1114306401 14:21427606-21427628 CTTGCTCTTGCCCTTTGTTTTGG + Intronic
1114306416 14:21427740-21427762 CTTGCTCTTGCCCTTTGTTTTGG + Intronic
1114306430 14:21427874-21427896 CTTGCTCTTGCCCTTTGTTTTGG + Exonic
1120644203 14:87052854-87052876 CTTGTTCCGGCAATTTCTTCAGG + Intergenic
1121537396 14:94700168-94700190 CGCGTTCTTGCTCTTTGTTTTGG - Intergenic
1202867198 14_GL000225v1_random:129096-129118 CTTGTCTAGGCTCTGTGTTTGGG + Intergenic
1123805962 15:23873731-23873753 CTTGCTGCTGCTCATTGTTTGGG + Intergenic
1125526344 15:40377783-40377805 ACTGTTCCGGCCCATTGTTTTGG - Intergenic
1131231039 15:90659740-90659762 CTAGTTCCTTCTCATTGTTTGGG - Intergenic
1132464115 16:69873-69895 CTTGTTCTGTCTCCTTGTCTAGG - Intronic
1132920129 16:2384686-2384708 CTTGTTCCTGATCTTTGTGGGGG + Intergenic
1133080775 16:3318136-3318158 CATGTTACTGCTTTTTGTTTTGG - Exonic
1134505322 16:14801128-14801150 GTTGTTCAGGCTCTTGGTTTGGG + Intronic
1134575256 16:15327782-15327804 GTTGTTCAGGCTCTTGGTTTGGG - Intergenic
1134727190 16:16428710-16428732 GTTGTTCAGGCTCTTGGTTTGGG + Intergenic
1134940247 16:18283145-18283167 GTTGTTCAGGCTCTTGGTTTGGG - Intergenic
1141809368 16:86364601-86364623 GTTGTTCCAGCTCTTGGTGTCGG - Intergenic
1144802566 17:17940576-17940598 CTTATTCCTGCTCTTTGTTCAGG - Intronic
1150750368 17:67856433-67856455 CTTTTTCCTATTCTTTGTTTTGG + Intronic
1152322390 17:79615098-79615120 CTCGTTCCTGCTCTTTTTTATGG - Intergenic
1156969288 18:43135351-43135373 CTTTTTCAGGTTCTTTGTCTGGG - Intergenic
1157027387 18:43861708-43861730 CTTGTCAAGGCTTTTTGTTTTGG + Intergenic
926134517 2:10326925-10326947 CATGCCCCGGCTCTTTGTCTCGG + Intronic
926944479 2:18171763-18171785 CTAATTCCTGATCTTTGTTTGGG + Intronic
927935997 2:27077116-27077138 CTTGTGACGGTTCTCTGTTTGGG + Intergenic
939877398 2:147593446-147593468 CTTGTTCTGTCTTCTTGTTTAGG - Intergenic
945187334 2:207152674-207152696 CTTGTTGAGTGTCTTTGTTTGGG - Intronic
1169894716 20:10490560-10490582 CTACTTCCTGCTCTTTTTTTGGG + Intronic
1171161760 20:22931871-22931893 CTTCCTCCGGCTCTTGGTCTGGG - Intergenic
1173418271 20:42877868-42877890 CTTGTTCTAGCTCTTAGCTTAGG - Intronic
1174111367 20:48200244-48200266 CTTGGTCCTGCTCCTTGTCTGGG - Intergenic
1176925546 21:14745047-14745069 CTTGTAGCCCCTCTTTGTTTTGG - Intergenic
1178938293 21:36883125-36883147 GTTGTTTCTGCTTTTTGTTTTGG - Intronic
1179353979 21:40641523-40641545 CTGGTTCCAGTTCTTTCTTTTGG + Intronic
1180849923 22:19012375-19012397 CTTTTTCTGCCTCTTTTTTTTGG + Intergenic
1181657130 22:24311955-24311977 CTTTTTCTGCCTCTTTTTTTGGG + Intronic
1183886354 22:40886397-40886419 CTTGTTCTTGCTCTTGGCTTTGG - Exonic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951524518 3:23640988-23641010 CTTGATTCAGCTCTTTGTCTAGG - Intergenic
954424585 3:50436677-50436699 GTTGTTACGGCTATTAGTTTGGG + Intronic
957012474 3:75023812-75023834 CTTGTTCCTGCTTTTAATTTTGG + Intergenic
957934357 3:86923317-86923339 CTTCTTACGGCTGGTTGTTTTGG - Intergenic
960722736 3:120640720-120640742 CTTTTTCGTGCTGTTTGTTTGGG + Intronic
961264723 3:125632583-125632605 ATTGTTCCGACTCTTTATCTAGG - Intergenic
962648795 3:137467082-137467104 CCTCTTCCGGCTGTTTCTTTGGG + Intergenic
962928107 3:140013400-140013422 CTTGTTCCGGCTCTTTGTTTTGG + Intronic
967520762 3:190429644-190429666 CCTGTTCCTGCTCCATGTTTTGG - Exonic
969017843 4:4116262-4116284 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
969736155 4:8992432-8992454 CTTGTTGCTGCTCACTGTTTGGG - Intergenic
975954534 4:79821895-79821917 CTTCTTCCTGCTCTTTGCTATGG - Intergenic
977236039 4:94508393-94508415 TTCCTTCCAGCTCTTTGTTTAGG - Intronic
979180393 4:117719334-117719356 CTTTTTCCATCCCTTTGTTTTGG - Intergenic
980778340 4:137464748-137464770 CATGTTCCTGCTCTTACTTTTGG + Intergenic
981010478 4:139920494-139920516 CTTTTTCTGCCTTTTTGTTTTGG - Intronic
984302035 4:177933331-177933353 CTTCTTCTTGCTTTTTGTTTAGG + Intronic
984846219 4:184110176-184110198 CTTCTTTCTGTTCTTTGTTTCGG + Intronic
986442528 5:7794504-7794526 CTTGCTCAGGCCCTTTGTGTGGG - Intronic
990566646 5:57036475-57036497 CTGCTTCAGGCTCTTTTTTTTGG - Intergenic
992456518 5:76921373-76921395 CTTGTTCCTTCTCTTTGGATGGG + Exonic
992742676 5:79790046-79790068 CTTGTGCCAGCTCTGTGTCTAGG - Intronic
993277214 5:85875783-85875805 CTAGTTCCTACTCTTTGTTTGGG - Intergenic
999962506 5:156771956-156771978 CTTGTTCTTGCTCTCTGTCTTGG - Intergenic
1001892402 5:175350430-175350452 CTTGTTCTGGCCCTCTTTTTAGG - Intergenic
1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG + Intronic
1004338088 6:14783053-14783075 CTTGCTGCTGCTCGTTGTTTGGG - Intergenic
1005873405 6:29994289-29994311 CTATTTCCGGCCCTTTGTTGGGG + Intergenic
1007437369 6:41824706-41824728 CTTGTTCTTGTTTTTTGTTTTGG - Intronic
1007589547 6:43013180-43013202 CTTGTTCAGGATCTTGGTTCAGG + Exonic
1011933441 6:92742360-92742382 CTTGTTTCAGCTCTTTGCTAAGG + Intergenic
1015289723 6:131524971-131524993 CTTGTTGCTGCTCACTGTTTGGG - Intergenic
1016274009 6:142327074-142327096 CTTGCTCCAGTACTTTGTTTGGG + Intronic
1018582324 6:165317745-165317767 CTTGTTCTTGGTGTTTGTTTTGG + Intergenic
1022518960 7:30993619-30993641 CTTGTTGCTGTTCTCTGTTTGGG - Intergenic
1022665041 7:32402925-32402947 CTTGTTGGGGCTCCTTGTTGGGG - Intergenic
1023038569 7:36153492-36153514 CGTGTCCCGGCTCTTTCTATGGG - Exonic
1029038024 7:97542046-97542068 CTTGCTGCTGCTCATTGTTTGGG + Intergenic
1029076279 7:97936790-97936812 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
1029220316 7:98983518-98983540 CTGGTTTCGTCTCTGTGTTTTGG + Intronic
1030767125 7:113423938-113423960 CTTATTCCGGGTCTTGGTTTTGG + Intergenic
1030860698 7:114622554-114622576 CCTTTTCTGACTCTTTGTTTTGG + Intronic
1031981538 7:128129909-128129931 CTTTTTCAGTCTCATTGTTTCGG + Intergenic
1032437258 7:131910267-131910289 CTTGCTGCTGCTCGTTGTTTGGG + Intergenic
1044039172 8:87343978-87344000 CTTTTTCATGCTCTTTGCTTAGG + Intronic
1046013395 8:108577067-108577089 CTTCTTCCCGCTCTTAGTGTTGG + Intergenic
1047393791 8:124475274-124475296 CTTCCTCCGGCTCTTTGGTAAGG + Exonic
1047876098 8:129139441-129139463 CTTCTTTCCACTCTTTGTTTAGG + Intergenic
1050511291 9:6398672-6398694 CATATTCTGGCTCTTTGTTTTGG + Intergenic
1050742163 9:8834741-8834763 CATGTTCCAGCTCATTGTTTTGG - Intronic
1050835418 9:10072455-10072477 CTTGTTGCTGCTCTCTCTTTGGG - Intronic
1051164529 9:14247820-14247842 CCTGTTCCTGCTTTTAGTTTAGG - Intronic
1056253719 9:84776832-84776854 ATTATGCCTGCTCTTTGTTTTGG + Intronic
1062170114 9:135130054-135130076 TTTGTTCAGGTTCTTTGTTCAGG - Intergenic
1188933499 X:36144670-36144692 CTTCTTCTGTCTCTTTGTTCTGG - Exonic
1191626432 X:63275827-63275849 CTTGTTCCATCCCTTTGCTTGGG + Intergenic
1193271214 X:79531582-79531604 CTTGTTGCTGCTCACTGTTTGGG + Intergenic
1195937924 X:110143005-110143027 CTTGGCCCGGCTCCTTGGTTGGG + Intronic
1200695280 Y:6353155-6353177 CTTGCTGCTGCTCATTGTTTGGG - Intergenic
1201039997 Y:9821555-9821577 CTTGCTGCTGCTCATTGTTTGGG + Intergenic