ID: 962929577

View in Genome Browser
Species Human (GRCh38)
Location 3:140023982-140024004
Sequence CTTCTAAGCAGTCAACAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962929564_962929577 30 Left 962929564 3:140023929-140023951 CCCTCTGCCCTGTCTCACAGTAG 0: 1
1: 0
2: 1
3: 22
4: 198
Right 962929577 3:140023982-140024004 CTTCTAAGCAGTCAACAAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 102
962929568_962929577 23 Left 962929568 3:140023936-140023958 CCCTGTCTCACAGTAGCAGGGAG 0: 1
1: 0
2: 1
3: 19
4: 172
Right 962929577 3:140023982-140024004 CTTCTAAGCAGTCAACAAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 102
962929565_962929577 29 Left 962929565 3:140023930-140023952 CCTCTGCCCTGTCTCACAGTAGC 0: 1
1: 0
2: 2
3: 14
4: 250
Right 962929577 3:140023982-140024004 CTTCTAAGCAGTCAACAAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 102
962929569_962929577 22 Left 962929569 3:140023937-140023959 CCTGTCTCACAGTAGCAGGGAGG 0: 1
1: 0
2: 2
3: 14
4: 184
Right 962929577 3:140023982-140024004 CTTCTAAGCAGTCAACAAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962929577 Original CRISPR CTTCTAAGCAGTCAACAAGG AGG Intronic
907791060 1:57663967-57663989 TTTATAAGCAGGCAACATGGAGG + Intronic
908224715 1:62044611-62044633 CTTCTAAGAAAGCAAAAAGGAGG - Intronic
909866561 1:80680314-80680336 CTATTAGGCAGTCAACAAGTAGG + Intergenic
911098898 1:94078424-94078446 ATTCCAAGCAGTCACCAAGTGGG - Intronic
914246732 1:145891904-145891926 TTTCTAAGCAGGCCCCAAGGAGG + Exonic
914959318 1:152192118-152192140 ATTCTGGGCATTCAACAAGGAGG - Intergenic
919444880 1:197690557-197690579 CTTCAAAGCAGTGGACAAGAGGG + Intronic
920085253 1:203410930-203410952 TTGCTAAGCAGTGAACAAGATGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
923211734 1:231809422-231809444 CTTGGAAGCAGATAACAAGGGGG - Intronic
1064135589 10:12747824-12747846 CTTTAAAGCAGTCAAGCAGGAGG + Intronic
1065203649 10:23338002-23338024 CTGCTAAACAGTTAACAAGATGG + Intronic
1067530211 10:47065570-47065592 CTTCTCAGCAATCCAAAAGGAGG + Intergenic
1068672271 10:59735177-59735199 CTTCCAGGCAGTAGACAAGGTGG - Intronic
1073043566 10:100623235-100623257 CTTCCAGGATGTCAACAAGGAGG + Intergenic
1074762376 10:116676599-116676621 CTTCTTAGCAGGCAGAAAGGGGG + Intronic
1075974927 10:126686643-126686665 CTTCCAAGCTGTCATCAAAGGGG + Intergenic
1076074871 10:127525387-127525409 CTTCTCGGCAGTGAACAGGGAGG - Intergenic
1077240867 11:1509946-1509968 CTGCTATGCAGTCATCAAAGAGG + Intergenic
1079051038 11:17159893-17159915 CTTCAAAGCAGTCAAGCAGGAGG + Intronic
1081203829 11:40251107-40251129 TTCCTAAGCAGTCAGAAAGGAGG + Intronic
1082206251 11:49437919-49437941 CTTCCAATCTGTGAACAAGGGGG + Intergenic
1082828825 11:57600295-57600317 CTTCTCAGCAATGAAGAAGGTGG + Exonic
1085473299 11:76771844-76771866 GTTGTAAGCACTCACCAAGGTGG + Intergenic
1086561712 11:88176031-88176053 CTGGTAATCAGTTAACAAGGAGG + Intergenic
1086649016 11:89263865-89263887 CTTCCAATCTGTGAACAAGGGGG - Intronic
1088215159 11:107499427-107499449 CTACTCAGAAGTCAACATGGTGG + Intergenic
1090025071 11:123160675-123160697 CTTCAAAGAAGTTGACAAGGGGG + Intronic
1093466640 12:19456301-19456323 CATCAAAGCAGTGAACAAGAAGG - Intronic
1098824253 12:75273046-75273068 CTTCAAAGCATGTAACAAGGTGG - Intergenic
1101813073 12:108124300-108124322 CTGCAAAGCAGGCATCAAGGTGG - Intergenic
1110070323 13:71167733-71167755 ATAATAACCAGTCAACAAGGTGG - Intergenic
1110863014 13:80365033-80365055 CCTCTAAACAATCAACAAGCTGG + Intergenic
1112063112 13:95761968-95761990 CTACTCAACAGTAAACAAGGAGG - Intronic
1116284035 14:42949146-42949168 CTTCTAAAAAATCAACGAGGAGG + Intergenic
1120082764 14:80234562-80234584 CTTCTAAACAGCCAATAAGAAGG - Intronic
1124269563 15:28268296-28268318 CTCCTAAGCCATCACCAAGGAGG + Intronic
1125770672 15:42163580-42163602 CTCCTAAGCAGTCTAAAAGCAGG - Intronic
1137932717 16:52603869-52603891 TTTTTATGCAGTCAACAAGAGGG + Intergenic
1141016769 16:80458193-80458215 CACCTGAGCAGTCAACAAGTAGG + Intergenic
1143477086 17:7208923-7208945 TTTCCAAGCAGTCAACAGAGGGG + Intronic
1145353115 17:22106612-22106634 CTTTTAATCAATCAAAAAGGAGG + Intergenic
1146714671 17:35075190-35075212 CTGCTGAACAGTCATCAAGGAGG + Intronic
1155425061 18:25698397-25698419 ATTTTAAGCAGTCATCATGGTGG - Intergenic
925641802 2:5992642-5992664 CTTCTCAACAGTCATCAGGGAGG + Intergenic
928191991 2:29179214-29179236 CTTCAAAGCAGTGAAAAAGGAGG - Intronic
938971811 2:136439630-136439652 CTTCCAGGCAGTGATCAAGGAGG - Intergenic
939812649 2:146853660-146853682 CTCAAAAGCAGTCATCAAGGTGG + Intergenic
942522595 2:176819791-176819813 CTTCAAGACAGGCAACAAGGAGG + Intergenic
947100061 2:226611003-226611025 CTTCTAAACAGTCCACAAATTGG - Intergenic
1169919950 20:10724628-10724650 TTTCTGAGCAGAAAACAAGGAGG + Intergenic
1178122342 21:29481885-29481907 CTTCAGATTAGTCAACAAGGAGG + Intronic
1184919968 22:47599183-47599205 CTTCTAGGAAGTCCCCAAGGGGG - Intergenic
949274229 3:2259234-2259256 CTGCTAACCAATCAACAAGGAGG + Intronic
950429545 3:12943068-12943090 CTTAAAAGCAGTCTACAAAGAGG + Intronic
952577413 3:34791933-34791955 CTTCTAAGCAATAATCAAGAGGG + Intergenic
952634897 3:35517415-35517437 CTGCTAAGATGTCAACCAGGAGG - Intergenic
952845532 3:37684952-37684974 CTTCCCTGCAGACAACAAGGGGG + Intronic
954431710 3:50474164-50474186 CCTCCCAGCAGTCACCAAGGTGG - Intronic
955096539 3:55804345-55804367 CTCCTAAGCAGACCACCAGGAGG - Intronic
959877486 3:111402150-111402172 ATTCTAAGTAGAGAACAAGGTGG - Intronic
961756997 3:129134076-129134098 CATCTATGCAGTCACCGAGGAGG - Exonic
961895783 3:130166844-130166866 CAACTAAGCAGGCATCAAGGAGG - Intergenic
962929577 3:140023982-140024004 CTTCTAAGCAGTCAACAAGGAGG + Intronic
964845823 3:161043181-161043203 TTTCTTAGCAGTCAACCAGAGGG + Intronic
965829556 3:172769055-172769077 CTTCAAAGCAGTCAGCAAGGTGG + Exonic
967953886 3:194862461-194862483 CTTCTAAGATATCATCAAGGAGG - Intergenic
969465270 4:7352746-7352768 CTTTGAAGCTGTCAACAGGGAGG + Intronic
969896780 4:10312815-10312837 CTACTTAGAAGTCCACAAGGAGG - Intergenic
970399933 4:15707534-15707556 CTGCAAAGCTGTTAACAAGGAGG - Exonic
974241522 4:59254923-59254945 CTTCTAAGTAGCAGACAAGGTGG + Intergenic
976750723 4:88449263-88449285 CATCTAATAAGACAACAAGGAGG + Intergenic
984293640 4:177826915-177826937 CTTCTTATCAGGCAAGAAGGGGG - Intronic
986049264 5:4072494-4072516 CTTCCAAAAAGTCAAAAAGGAGG - Intergenic
986808906 5:11335053-11335075 CTACTAAGAAGACAAGAAGGAGG - Intronic
989121821 5:38012065-38012087 TTTCAAAGCAGTGAACCAGGAGG + Intergenic
992081831 5:73240875-73240897 CTGCTAAGAAGACAACATGGAGG + Intergenic
992160939 5:74001025-74001047 CTTCTGAGCAGGCTACATGGAGG - Intergenic
993614670 5:90096916-90096938 TGTCAAAGCAGTCAGCAAGGAGG + Intergenic
995485287 5:112634207-112634229 CTTCTAAGCTGTCACCAAGAAGG - Intergenic
996256954 5:121415979-121416001 TGTCTAAGCAGTGGACAAGGAGG - Intergenic
998798638 5:145845313-145845335 CTTATGATCAATCAACAAGGGGG + Intergenic
999639687 5:153660011-153660033 CTCCTATGAAGTAAACAAGGTGG + Intronic
1000577300 5:162990163-162990185 CTTCTACAAAGGCAACAAGGAGG + Intergenic
1001239544 5:170057599-170057621 CTTGTATGCAGTCACGAAGGAGG - Exonic
1003888307 6:10540781-10540803 CTTTTAAGCAGTCCACAGGGTGG + Intronic
1004013912 6:11715059-11715081 CTTCTATTCAGCCAACAAGTTGG + Intronic
1013659515 6:112280691-112280713 CTTCTAAGCAGCCTTCAAGGAGG + Intergenic
1015515958 6:134082796-134082818 CTTGTCAGAAGTCAACATGGTGG + Intergenic
1017281254 6:152628457-152628479 CTTTGCAGCACTCAACAAGGAGG + Exonic
1019261720 7:85710-85732 CTTGTCAGCAGGCAGCAAGGAGG - Intergenic
1024785959 7:52908304-52908326 CATCTAAGCATTCTACAAGTTGG + Intergenic
1025274362 7:57563562-57563584 CTTTTAATCAATCAAAAAGGAGG - Intergenic
1026328117 7:69328603-69328625 CTTCTAAGCAAACACCAAAGTGG + Intergenic
1026693358 7:72569405-72569427 CTTCTCAGCAGAAAACATGGAGG - Intronic
1028969498 7:96841894-96841916 CACCTAAGAAGGCAACAAGGAGG + Intergenic
1042699455 8:71596092-71596114 CATCTAAGGATGCAACAAGGAGG + Intergenic
1047857869 8:128932275-128932297 CTTGCAAGCACTCAACAAGGTGG - Intergenic
1052247711 9:26357586-26357608 CTTCTAACTAGGAAACAAGGAGG + Intergenic
1053306867 9:36990770-36990792 TTTCTAAGCAGTGAAGATGGTGG + Intronic
1053471218 9:38347160-38347182 CTCCTCACCAGGCAACAAGGGGG + Intergenic
1055743025 9:79410654-79410676 ATTCAAAGCAGTCAAGAAAGGGG + Intergenic
1056686971 9:88774824-88774846 CTACGAGGCAGTCAAGAAGGAGG + Intergenic
1057962130 9:99466816-99466838 CTTCTAAGGATTCAATAAGATGG + Intergenic
1060371138 9:123072819-123072841 CTTCAAAAAAGTCAAGAAGGTGG - Intronic
1186945829 X:14566398-14566420 CTTCTAAGAAGTAGGCAAGGAGG + Intronic
1187197866 X:17105362-17105384 CTTCCATGCATTCAACCAGGTGG - Intronic
1189554273 X:42126069-42126091 CATCTGAGCTGTCATCAAGGAGG - Intergenic
1190651782 X:52575112-52575134 CTGAAAGGCAGTCAACAAGGTGG - Intergenic
1191914788 X:66189858-66189880 CATCTCAGCAGTCACAAAGGTGG - Exonic
1197986345 X:132269932-132269954 CTTCTAAGCAGAAAACAAGATGG - Intergenic
1200243862 X:154512469-154512491 CCTATTACCAGTCAACAAGGTGG + Intronic