ID: 962930288

View in Genome Browser
Species Human (GRCh38)
Location 3:140029672-140029694
Sequence ATGAGAAATGCTTATACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962930287_962930288 -9 Left 962930287 3:140029658-140029680 CCAAACACATAGAGATGAGAAAT 0: 1
1: 1
2: 149
3: 780
4: 1697
Right 962930288 3:140029672-140029694 ATGAGAAATGCTTATACAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 183
962930286_962930288 27 Left 962930286 3:140029622-140029644 CCTGGGGAATATCTGTATATAAG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 962930288 3:140029672-140029694 ATGAGAAATGCTTATACAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962930288 Original CRISPR ATGAGAAATGCTTATACAGC AGG Intronic
908838678 1:68256111-68256133 AAGAGAAATGCTTATTCAATTGG - Intergenic
913426281 1:118734426-118734448 ATGCTAAATGCTTATATAGAAGG + Intergenic
915583442 1:156830046-156830068 GAGAGCAATGCTTAGACAGCGGG - Intronic
916129607 1:161601026-161601048 ATGAGAAATGCTTATGTTACAGG + Intronic
917023793 1:170619307-170619329 ATGAGACAAGCTTATGGAGCTGG + Intergenic
917653495 1:177102602-177102624 ATTAAAAAGGCTTAAACAGCTGG + Intronic
917969005 1:180195484-180195506 AGGAGAAGTGCTTCTACAGAAGG + Intronic
918135756 1:181672752-181672774 ATAAGAAATGCCTAGAAAGCAGG - Intronic
918299598 1:183191028-183191050 ATGAGAATTGTTTAGACAGCTGG + Intronic
919439166 1:197606590-197606612 ATAAGAAATGCTTGTACAGTTGG - Intronic
921795112 1:219333815-219333837 ATGAGAAAGGCTGATTCAGCTGG - Intergenic
922247177 1:223812233-223812255 ATGAGAAATGCTGATACTTAGGG - Intronic
922683844 1:227624241-227624263 ATAACAAATACATATACAGCTGG + Intronic
922758631 1:228110124-228110146 ATCCGAAAGGCTGATACAGCGGG + Intergenic
924446906 1:244141173-244141195 ATGAGTAATGATTATACAATGGG + Intergenic
1064705119 10:18063943-18063965 ATGAGAAATGCTAAACCAGTAGG - Intergenic
1064759230 10:18601654-18601676 ATGAGAACTGCTAATCCAGCTGG - Intronic
1065199136 10:23297146-23297168 ATTAGAAATGCTTATAGAAGGGG - Intronic
1065280053 10:24127522-24127544 CTGACAAATCCTTTTACAGCCGG + Intronic
1066241701 10:33542555-33542577 ATGATAAAGGCTTATAAAGATGG - Intergenic
1068294683 10:55054642-55054664 AAAAGAAATGCTTATACTGTTGG - Intronic
1071391314 10:85177827-85177849 CTGAGAAATGCTTCTAGACCTGG + Intergenic
1071693400 10:87846567-87846589 ATGATAAAACATTATACAGCAGG - Intergenic
1073316311 10:102583320-102583342 ATCAGAAATGCTTGGAGAGCAGG - Intronic
1073957466 10:108889804-108889826 ATGAAGAATGCTTAGATAGCTGG - Intergenic
1075213554 10:120512123-120512145 CTCAAACATGCTTATACAGCTGG - Intronic
1075966677 10:126617843-126617865 ATGAGAATAGATTATACAGTCGG + Intronic
1078649658 11:13176981-13177003 TTGAGAAATGCTGAGACATCTGG + Intergenic
1079763520 11:24359433-24359455 AAGAGAAATGATTCTTCAGCTGG - Intergenic
1079808838 11:24969439-24969461 ATAAGAAATAAATATACAGCAGG - Intronic
1079989225 11:27229565-27229587 TTGAGAAATGCTATTACAGGTGG - Intergenic
1082701424 11:56436435-56436457 ATAATGAATCCTTATACAGCAGG + Intergenic
1086166286 11:83782700-83782722 ATGAGAAAGGCTGATACTGTGGG + Intronic
1089236722 11:117034350-117034372 ATGTGAAATCCTTATACTTCAGG + Intronic
1091439513 12:501732-501754 ATGAGAAATTCTAATTCAGGAGG + Intronic
1092051018 12:5470267-5470289 ATGAGAAGAAGTTATACAGCTGG + Intronic
1093821071 12:23618235-23618257 AAGAGAAATGCTTGTTCATCAGG + Intronic
1095328345 12:40926010-40926032 ATGAGTATTTGTTATACAGCAGG + Intronic
1098071797 12:66683832-66683854 TTGAGAAATGCTTGTACAAGAGG + Intronic
1099193204 12:79582173-79582195 AGGAGAAATGCTTGAACTGCGGG + Intronic
1100152386 12:91755129-91755151 CAGAGAAATGCTTATACAATAGG + Intergenic
1101799793 12:108011071-108011093 ATGAGAAATGAATATAATGCTGG - Intergenic
1102363005 12:112304634-112304656 ATGAAAATTCCTTAAACAGCTGG + Intronic
1103367692 12:120394998-120395020 ATGAGAATGGGTTATACAGGAGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1111400988 13:87734752-87734774 ATCAGCAATGCTAATATAGCTGG + Intergenic
1111945639 13:94662365-94662387 ATGAAAAATGAAGATACAGCGGG - Intergenic
1114301201 14:21379999-21380021 ACAGGAAATGCCTATACAGCTGG + Intronic
1117167993 14:53059126-53059148 ACGAGAAAGGTTTCTACAGCTGG + Intronic
1117682358 14:58217369-58217391 ATCAGAAATGCAAATACGGCTGG + Intronic
1120192369 14:81450896-81450918 CTGAGAAATTCTCATTCAGCAGG - Intergenic
1121906842 14:97753762-97753784 AGGAGAATTGCTTATAAACCGGG - Intronic
1125574292 15:40744840-40744862 ACGAGAAATGGTGAGACAGCTGG - Intronic
1127832845 15:62766099-62766121 ATGAGAGATGCTTTTGCAACTGG - Intronic
1129015685 15:72466644-72466666 ATTAAAAATGCATATGCAGCCGG + Intergenic
1133436844 16:5787042-5787064 AGGAGAATTGCTTAAACAGGAGG + Intergenic
1134111520 16:11518108-11518130 ATCAGAAATGCTAAGTCAGCGGG - Intronic
1134327298 16:13218781-13218803 ATGAGAAATGCTCATGCAGGAGG + Intronic
1137393039 16:48097444-48097466 AAGACAATTGCTTATAAAGCTGG + Intronic
1138171926 16:54859548-54859570 ATGAGAATTGCTTGAACAGGGGG + Intergenic
1138751323 16:59425421-59425443 ATGAAAACTGCTTACACAACTGG - Intergenic
1143192972 17:5054007-5054029 ATGAGAATTGCTTGAACAGGAGG - Intergenic
1143462587 17:7113820-7113842 ATGAGGAATGCAGATTCAGCTGG - Intronic
1148544432 17:48506538-48506560 CTGAGAAATCCATCTACAGCGGG - Intergenic
1154153309 18:11924751-11924773 ATGGTAAATGCCTATACAGGGGG + Intergenic
1155370929 18:25099699-25099721 ATAATAAATGCATATACATCTGG - Intronic
1156129369 18:33951858-33951880 CTGAGAAATGTATATAAAGCTGG - Intronic
1156985329 18:43344292-43344314 TTGAGAACTGCTTATTTAGCAGG - Intergenic
1158261020 18:55605665-55605687 ATGAAAAATGCATATGCAACTGG - Intronic
1159203017 18:65212464-65212486 CTAAGAAATGCTCAGACAGCTGG - Intergenic
1160180189 18:76627790-76627812 TTGAGAATTGCTTATACATGAGG - Intergenic
1163751377 19:19080265-19080287 ATGGGAAATGCTTCCTCAGCAGG + Intronic
1165223865 19:34340379-34340401 TTGAGAAATGTGTATACATCTGG + Intronic
1167222829 19:48214197-48214219 CTGAGAGATGCTGTTACAGCAGG + Intronic
1167841633 19:52126423-52126445 ATGAGAATTGCTTGAACAGGAGG + Intronic
924965900 2:76338-76360 GTGAGAAAGGCTTATACAGTAGG - Intergenic
927288649 2:21382690-21382712 ATGAGAAAAGCTAAAACATCTGG + Intergenic
927836931 2:26406617-26406639 ATGAGAATTGCTTGAACACCGGG + Intronic
928077620 2:28279484-28279506 ATGAGAAATGCTAAAACAGGAGG - Intronic
934129571 2:88935109-88935131 ATGAGAAATGCTGATTCTTCTGG - Intergenic
935762979 2:106338570-106338592 ATGAGAAATGCTCAAGCACCAGG + Intergenic
940159865 2:150699958-150699980 AAGAGAAATGCTAAACCAGCCGG - Intergenic
944950399 2:204742165-204742187 ATAAGAAATACTTATTCAGAAGG - Intronic
1170104497 20:12738728-12738750 AAGACAGATGATTATACAGCAGG - Intergenic
1170781714 20:19431265-19431287 AAGAGAAATGCCTATAAAGAGGG + Intronic
1171253180 20:23666006-23666028 CTGAGAAATATTTATACAGCAGG + Intergenic
1171259668 20:23721333-23721355 CTGAGAAATATTTATACAGCAGG + Intergenic
1171268731 20:23796791-23796813 CTAAGAAATATTTATACAGCTGG + Intergenic
1172217177 20:33244014-33244036 AAAAGGAATGCTTATACTGCTGG + Intergenic
1172442148 20:34973373-34973395 GTGAATAATGCTTCTACAGCTGG - Intergenic
1175877146 20:62235748-62235770 CTGAGAAATGCTCATCCTGCAGG - Intronic
1176582121 21:8541137-8541159 ATGAAAAATGCTTTTAGAGATGG + Intergenic
1177723368 21:24936206-24936228 ATGAGATATGTGTGTACAGCTGG + Intergenic
1177973211 21:27816186-27816208 ATGAGCACTGCTTAAAAAGCTGG - Intergenic
1179062346 21:37990627-37990649 ATCAGAGATGCTTATAAGGCTGG + Intronic
1180264956 22:10518185-10518207 ATGAAAAATGCTTTTAGAGATGG + Intergenic
1183126366 22:35785157-35785179 ATTAAAAATGCATATTCAGCCGG - Intronic
949702909 3:6779913-6779935 ATAATAAATGATTAAACAGCAGG - Intronic
949798629 3:7878549-7878571 CTGAGAAATGCTCAGATAGCAGG + Intergenic
950185831 3:10945006-10945028 CTCAGAAATGCTCTTACAGCGGG + Intergenic
950199093 3:11030133-11030155 ATGAGAAATGCTCACATAGCTGG + Intronic
950755978 3:15172973-15172995 TTGAGAAATGCTTATGCAATTGG + Intergenic
951431530 3:22613344-22613366 TAGAGAAATGCATATACAGTAGG - Intergenic
953261610 3:41344659-41344681 ATGAGAAATGCTTAAACTCGGGG + Intronic
955664662 3:61337686-61337708 AGGAGAATTGCTTCAACAGCTGG - Intergenic
957133602 3:76255758-76255780 ATGAGAATTGTCTATACAACAGG - Intronic
957925188 3:86800244-86800266 CTAAGAAATGCTTCTAAAGCCGG - Intergenic
958131213 3:89426631-89426653 ATGAGAAATGGTCATAAGGCTGG + Intronic
959562698 3:107800705-107800727 ATGAGAAATGCTTAGTCAGTTGG + Intronic
962930288 3:140029672-140029694 ATGAGAAATGCTTATACAGCAGG + Intronic
966566292 3:181385167-181385189 TTGAGAAATGCTTACACATTGGG + Intergenic
968176732 3:196557025-196557047 ATGAGAACTGCTTGAACAGCTGG - Intronic
968319578 3:197753255-197753277 ATGTGAAATTCATATACACCTGG - Intronic
968886004 4:3332781-3332803 AGGAGAAAAGATTATACATCTGG - Intronic
969254067 4:5990670-5990692 AGGAGAAAGGCTTCTGCAGCTGG + Intergenic
970422356 4:15917007-15917029 CTGAGACAGGCATATACAGCTGG + Intergenic
976089190 4:81438164-81438186 ATGAGAAATGGTTAAAAACCTGG + Intronic
976163814 4:82231898-82231920 ATGAGAGCTGCTCATACAGCTGG + Intergenic
981555438 4:145988351-145988373 AGGAGAACTGCTGATACACCTGG + Intergenic
984611249 4:181841415-181841437 ATGAGAGATTCTGATTCAGCAGG - Intergenic
985191636 4:187380803-187380825 ATGAGAATTGCTTGTACATTAGG + Intergenic
985522323 5:381246-381268 TTGAGAGATGCCTAGACAGCTGG - Intronic
986864624 5:11972029-11972051 ATGATAAATGATTATAAACCAGG + Intergenic
987860867 5:23486323-23486345 ATAAGGGATGCTTATACTGCTGG - Intergenic
988252802 5:28782231-28782253 TTGAAGGATGCTTATACAGCTGG + Intergenic
988352379 5:30126895-30126917 ATGACAGATGCATATACAACAGG - Intergenic
988731000 5:33972488-33972510 CTGAGAAATGCTTGTACTGAAGG + Intronic
988772754 5:34448691-34448713 ATGAGAAACTTGTATACAGCTGG - Intergenic
989435798 5:41411536-41411558 ATAAGAAATGTTTATAAAACTGG + Intronic
989748583 5:44862534-44862556 TTGATAAATGGTTATTCAGCCGG + Intergenic
992551192 5:77861902-77861924 ATGAAAAATGCTTTTACAGGAGG - Intronic
993058761 5:83013913-83013935 GTAAGAAATTCTTATACTGCTGG + Intergenic
994629388 5:102264986-102265008 ATGCGAAATGTATATACAACAGG - Intronic
995466009 5:112450085-112450107 ATTAGAAATGCTTATAGAAGGGG + Intergenic
995546807 5:113240668-113240690 ATGAGAAATCCTGTTACAGTTGG - Intronic
995629138 5:114114128-114114150 ATTAGAAGTGGTTATACAGAAGG + Intergenic
998601078 5:143585699-143585721 ATGAGAAATGCTAAGATTGCTGG + Intergenic
1001438008 5:171715450-171715472 ATGAGAAAAGGTAAAACAGCAGG - Intergenic
1001720268 5:173851407-173851429 ATGAGAAATTCATATAAAGATGG + Intergenic
1001739917 5:174044566-174044588 ATGACAAATGCCAAGACAGCTGG + Intergenic
1003281936 6:4700864-4700886 ATCAGAAAGGGTTATACAGGAGG + Intergenic
1004404745 6:15322574-15322596 ATGAGAAATGCTTAGATTTCAGG + Intronic
1005903936 6:30243931-30243953 TTGAGAAATGGGTATACACCAGG - Intergenic
1006654318 6:35577189-35577211 ATGAGAAAGGCTTGTATAGGAGG - Exonic
1008920084 6:56834229-56834251 ATAAAAAATGCTTAAAAAGCGGG + Intronic
1010617137 6:78027520-78027542 ATGGGAAATGATTTTACTGCAGG + Intergenic
1010794011 6:80098368-80098390 CTGAGAAATTCTTATTCAGTAGG - Intergenic
1013033044 6:106354835-106354857 TTGAGAAATGCTTGTACCCCAGG - Intergenic
1013558426 6:111281041-111281063 TTGACAAATGTTTATTCAGCCGG + Intergenic
1014059413 6:117052913-117052935 ATCAGGACTGCTTATACAACAGG + Intergenic
1015435839 6:133186684-133186706 ATGAGGAATGGTAATACAGTTGG + Intergenic
1016663926 6:146612388-146612410 ATGGGAAGTGTGTATACAGCTGG - Intronic
1016948142 6:149553140-149553162 ATGAGAAATGATTTCACATCTGG - Intergenic
1020647988 7:10839132-10839154 ATGAGAAATGTTTAAATACCGGG - Intergenic
1021547639 7:21832889-21832911 ATAAGAAATCCTTCTAGAGCAGG - Intronic
1021920040 7:25475795-25475817 ATAAGAAAAGATTATTCAGCTGG + Intergenic
1023068167 7:36400656-36400678 TTTAGAAATGCTTCTACTGCTGG - Intronic
1024486539 7:49926350-49926372 ATGAGAAATGCCTAAGCTGCAGG - Intronic
1025933458 7:66014900-66014922 ATGAGAAATTTTGAGACAGCTGG + Intergenic
1026410391 7:70115295-70115317 ATGAGAGATACATATCCAGCTGG - Intronic
1030953570 7:115822584-115822606 TTGACAGATGCTTAGACAGCTGG + Intergenic
1031672524 7:124567324-124567346 ATGAGAAAGTTTTATACAGGTGG + Intergenic
1034541325 7:151760127-151760149 AGGAGAAGTGAATATACAGCAGG + Intronic
1038081056 8:24136632-24136654 AGGAGAAAGGCTTCTACAACAGG - Intergenic
1038460093 8:27709096-27709118 ATGAGAAATGCTCCTTCAGGTGG - Intergenic
1038915073 8:32012273-32012295 ATGAAAAATGCTTGGACAACAGG + Intronic
1038966829 8:32582750-32582772 TTGGAAAATGCTTATTCAGCGGG - Intronic
1041219157 8:55631933-55631955 GTGAGAAAAGCTTAGACAGATGG - Intergenic
1042695018 8:71546980-71547002 ATGAAAAGTGTTTACACAGCGGG + Intronic
1043920396 8:85976283-85976305 ATGAGAAGGGTTTAGACAGCTGG - Intergenic
1050114141 9:2245664-2245686 AAGGGAAATGATTATACAGAGGG - Intergenic
1050127564 9:2375082-2375104 TTGAGAAATGTTTATTCAGATGG - Intergenic
1051055468 9:12979909-12979931 ATGAGAAATGCTCATAGACTTGG - Intergenic
1051235510 9:14994264-14994286 ATGAAGAATGCCTATACAACTGG - Intergenic
1051694477 9:19753210-19753232 ATGAGAAATGATTCTGCTGCAGG - Intronic
1051979208 9:22993448-22993470 ATGAGAGATGCTCTTAAAGCAGG + Intergenic
1055197416 9:73613038-73613060 AGGAGAAATGCTTGTACACATGG + Intergenic
1055771506 9:79721767-79721789 ATTAGAAATGTCAATACAGCTGG - Exonic
1055933944 9:81587780-81587802 ATTAGAAATGTCAATACAGCTGG + Exonic
1056295197 9:85186002-85186024 ATTTGAAATTCTTATTCAGCAGG - Intergenic
1056468718 9:86884518-86884540 CTGAGAGATGCTTATGCAGGTGG + Intergenic
1057950389 9:99365163-99365185 ATTTGAAATGCAAATACAGCCGG + Intergenic
1058356696 9:104092215-104092237 ATGAAAAATGCTTATAAAGGTGG - Intergenic
1058507498 9:105680998-105681020 ATGATAAATGCTATAACAGCAGG - Intergenic
1060211345 9:121712383-121712405 GGGAGCAATGCTTATGCAGCAGG + Intronic
1061460979 9:130738513-130738535 ATGAGTGATGGTAATACAGCAGG + Intronic
1203612138 Un_KI270749v1:19154-19176 ATGAAAAATGCTTTTAGAGATGG + Intergenic
1185555158 X:1015432-1015454 ATGAGAATTTCTTAGTCAGCAGG - Intergenic
1186380637 X:9055079-9055101 ATGAGGAATGGTTATCCAACAGG - Intronic
1186941355 X:14511115-14511137 ATGATAAAAGCCTATACAACTGG + Intergenic
1188327643 X:28825178-28825200 ATGAGAACTTGATATACAGCAGG + Intronic
1189498872 X:41535439-41535461 ATGAGAAATGCATGGACAGCTGG + Intronic
1196639923 X:118047014-118047036 GTGAGGAATGCAAATACAGCAGG + Intronic
1196815143 X:119659586-119659608 ATATGAAATGCTTAAACACCTGG - Intronic
1197091524 X:122544136-122544158 ATGAGAGATGTATATACAGATGG - Intergenic
1199174013 X:144763580-144763602 AGGAGAATTGCTTAAACCGCTGG + Intergenic
1199322190 X:146453358-146453380 ATGAGACATACATATGCAGCCGG - Intergenic
1200331011 X:155297950-155297972 TTGCGAAATGCCTATACAGAGGG + Intronic
1201741826 Y:17332404-17332426 GTGAGAAATTGTGATACAGCAGG + Intergenic
1202091181 Y:21192531-21192553 ATGGGCAGTGTTTATACAGCAGG - Intergenic