ID: 962930470

View in Genome Browser
Species Human (GRCh38)
Location 3:140031220-140031242
Sequence CTTCACATGCAGAATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962930470 Original CRISPR CTTCACATGCAGAATGTGGA GGG Intronic
900749696 1:4387591-4387613 GTTCTCATGCTGAATGAGGATGG + Intergenic
903736984 1:25536208-25536230 CTTCACATGGAGCATGTGTGGGG - Intergenic
904834486 1:33326107-33326129 ATTTTCAGGCAGAATGTGGAAGG + Intronic
905850171 1:41268150-41268172 CTCCACATCCAGATTGTAGAGGG - Intergenic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
906932156 1:50180623-50180645 CTTCCAATGCATAGTGTGGATGG + Intronic
908413158 1:63886632-63886654 CTTCTCCTTCAGAATGTTGAAGG + Intronic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
913577181 1:120188088-120188110 ATTCACATGCAAAATGATGATGG + Intergenic
914559094 1:148799523-148799545 ATTCACATGCAAAATGATGATGG + Intergenic
914613739 1:149330706-149330728 ATTCACATGCAAAATGATGATGG - Intergenic
917779787 1:178381305-178381327 CTTCTCATGCAGATTATGGCAGG - Intronic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924299277 1:242620813-242620835 CTCCTCATGGACAATGTGGAGGG - Intergenic
1063001646 10:1929808-1929830 CTTCACACGTAGAGTGGGGATGG + Intergenic
1065986383 10:30957272-30957294 GTTAACATCCAGAATGTGTAAGG - Intronic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1074195614 10:111182034-111182056 CTTCACATTCAAATTTTGGATGG + Intergenic
1074459452 10:113624137-113624159 ATTCACATGCAGAAAGGGAAAGG - Intronic
1075265058 10:120993388-120993410 ATTTACATGCAAAATGTGCAAGG + Intergenic
1075484660 10:122812520-122812542 CTTCACAAGTAGAGTGTAGAGGG + Intergenic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1081319987 11:41680073-41680095 CTTAAAATGCAGAATGGTGAAGG + Intergenic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091345998 11:134854602-134854624 CTCCATGTGCAGAATGTGCAGGG + Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG + Intergenic
1094320774 12:29180460-29180482 CTAAACATGAAGGATGTGGATGG - Intronic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1101958983 12:109233954-109233976 GGACACATTCAGAATGTGGATGG - Exonic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1105887382 13:24653461-24653483 GGTCTCCTGCAGAATGTGGAAGG - Intergenic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1106751701 13:32778169-32778191 CTTCTCATGCAAAATGTTGGCGG + Intergenic
1108005786 13:45944921-45944943 TTTCACAAGCAGACTTTGGAGGG - Intergenic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1109646742 13:65268468-65268490 CTTAACATGCAGAATTTATAAGG - Intergenic
1111409341 13:87854035-87854057 GTTCCCATTCAGATTGTGGAAGG - Intergenic
1112376816 13:98850307-98850329 GTTCAAATGCAGCATGTTGAAGG - Intronic
1112944708 13:104914084-104914106 CTTCATTTGGAGAATGCGGATGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1115600585 14:34952031-34952053 CTCCACATACAGAATATTGAAGG + Intergenic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG + Intronic
1122098385 14:99387864-99387886 GTCCACATGCATAATGTTGATGG + Intergenic
1122281100 14:100622895-100622917 GATCAAATGCAGAATGTGGGTGG + Intergenic
1123917757 15:25049360-25049382 TTTCACATGCAGGATGGGCATGG - Intergenic
1129750507 15:78059581-78059603 CACCTCAAGCAGAATGTGGATGG - Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG + Intronic
1133858613 16:9573318-9573340 CTGCAAATGCAAAGTGTGGATGG + Intergenic
1136238248 16:28928048-28928070 CTTGACATGCGGAGTGTAGATGG + Intronic
1137705804 16:50535062-50535084 CTTCCCATCCAGACTGTGGTTGG + Intergenic
1137757395 16:50913519-50913541 CTTAGCATGTAGACTGTGGAAGG + Intergenic
1138352973 16:56356274-56356296 CTTCACATTTAGAATTTGAAAGG + Intronic
1138986780 16:62338588-62338610 CTTCATAAGTAGAATGTGTAGGG - Intergenic
1139062474 16:63270115-63270137 CTTCACAGGCAGAATGGGACAGG - Intergenic
1139691050 16:68642397-68642419 CTTGCCATCCAGAGTGTGGAGGG - Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1142886603 17:2916621-2916643 CTTCACTTGCATAATAGGGACGG + Intronic
1143017142 17:3896889-3896911 GTTCACATACACAGTGTGGAAGG + Exonic
1143666594 17:8365677-8365699 CTTCACATGCAGAATCTCGCTGG + Intergenic
1143813230 17:9489484-9489506 CTTTACATGCATAATTTGGTGGG - Intronic
1144908881 17:18661840-18661862 CCTCACATGCATATTATGGATGG + Exonic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1147930715 17:43978851-43978873 CTTCTGATGCAGAGTATGGAGGG - Intronic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1153569241 18:6451835-6451857 CTTCACATACAGCCTGTGGCAGG - Intergenic
1153976732 18:10274815-10274837 CTTCACCTGAAAAATGTGAATGG + Intergenic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1155540752 18:26865556-26865578 CTTCTTAGGCAGAATCTGGAAGG - Intronic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG + Intronic
1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG + Exonic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1164515185 19:28928258-28928280 ATTCTCATCCAGAAAGTGGAGGG + Intergenic
1165261096 19:34618691-34618713 TTTCACATGCAGGGTGTGTAAGG - Intronic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
924983627 2:247104-247126 CTTTACTTAAAGAATGTGGAGGG + Intronic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
925139948 2:1543221-1543243 CTTCACATGTGAAATGAGGACGG - Intronic
925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG + Intronic
927078210 2:19601449-19601471 TTTCTCATGATGAATGTGGATGG + Intergenic
927411163 2:22828032-22828054 CTTCACAAGCAGCAAATGGAAGG + Intergenic
927585011 2:24294898-24294920 CTTCACATGCAGAAAGGGTAAGG - Intronic
927742250 2:25582016-25582038 CTTCACATTAAGAAAGTGGTGGG - Intronic
928064024 2:28145035-28145057 CTTTAGATTCAGAATGTGGGTGG - Intronic
929480460 2:42302488-42302510 AATCACATGAAGAATGTGGTCGG - Intronic
930341671 2:50123831-50123853 CTTCAGATGGATATTGTGGAAGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932127980 2:69161838-69161860 CTTCTCATGCAGAATTTAAAAGG + Intronic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG + Intergenic
936729190 2:115360420-115360442 TTTCACAGGCAGTGTGTGGAAGG + Intronic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
940741077 2:157508323-157508345 CTTAACATGAAGTATATGGATGG + Intergenic
943166940 2:184340894-184340916 CCTCACATCCAAAATTTGGATGG + Intergenic
943897135 2:193378489-193378511 CTTCACCTGCAGAAGATGTAAGG + Intergenic
944219801 2:197291576-197291598 TTTCTCATGCAGAATTTGGCTGG - Intronic
944330407 2:198458787-198458809 ATTTACATGCAGAATTTAGAGGG + Intronic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
946263418 2:218516666-218516688 GGACACATGCAGAATGTGCAAGG - Intronic
946594551 2:221291934-221291956 CTTCCCATACATAATGAGGATGG - Intergenic
948327514 2:237137859-237137881 CCACACAGGCAGAATGTTGAGGG - Intergenic
948507612 2:238440470-238440492 CAACACAGGCAGTATGTGGAGGG - Intronic
1169399262 20:5265871-5265893 GTTCACATGTAGGATGTAGACGG + Intergenic
1172025009 20:31942645-31942667 CTCCAGATGCTGAATGTGGATGG - Intronic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176518560 21:7806528-7806550 CTTCACAGGAATAATTTGGAAGG - Intergenic
1177414130 21:20772350-20772372 AGACACATGCAGAATGTGCAGGG - Intergenic
1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG + Intronic
1178652588 21:34436541-34436563 CTTCACAGGAATAATTTGGAAGG - Intergenic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179085011 21:38208163-38208185 GTTAACATGCAGATTGTGCAGGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1182488541 22:30654423-30654445 CTTCAGATGCACAACCTGGAGGG + Intronic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1182715171 22:32352543-32352565 CATCTCCTGCAGAATCTGGAGGG - Intergenic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
956256625 3:67290202-67290224 CATCCCATGGAGAATATGGATGG - Intergenic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956595752 3:70965282-70965304 CTGCCCATGCTGAATGTGAATGG - Intronic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
959557175 3:107733894-107733916 CTACAAATGCAGACTGTGCATGG - Intronic
962473956 3:135739727-135739749 ATTCAAATGCATAAAGTGGAGGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963943819 3:151123174-151123196 CTTGATATGCAGAATGTTTAGGG - Intronic
964116082 3:153137689-153137711 CTTCACATGGCAAATGGGGAAGG - Intergenic
964735271 3:159911044-159911066 CTTCACATGCACAGTATGAATGG + Intergenic
964979299 3:162659737-162659759 CTTCACATGCAAATAATGGATGG - Intergenic
965768058 3:172152553-172152575 CTTCCCATGGAGAATGTGAGTGG - Intronic
967527911 3:190515030-190515052 TTTCACAACCAGAAGGTGGAGGG - Intronic
971047128 4:22817461-22817483 CTTAACATGGAGTCTGTGGATGG + Intergenic
971082285 4:23227239-23227261 ATTCACTTGCAGAATGAGTAGGG + Intergenic
978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG + Intronic
983522498 4:168724768-168724790 CTTCACATACAGAGGTTGGAAGG - Intronic
985129750 4:186727172-186727194 ATTCACATCCAGAAGTTGGAGGG - Intergenic
985362578 4:189191537-189191559 GTTCACATGAGGAATGAGGATGG + Intergenic
987579996 5:19777523-19777545 CTTCACAAGCACAGTGTGGCCGG - Intronic
988691594 5:33577872-33577894 CATGGCATACAGAATGTGGAGGG - Intronic
988726309 5:33929905-33929927 CTTCACTTGCAGAATGGGCTCGG + Intergenic
993048194 5:82892970-82892992 CTTCACTAGCAGAATGTGCTGGG + Intergenic
994465686 5:100126897-100126919 CTTCATAAGCAGAATATGAAAGG + Intergenic
994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG + Intergenic
996057491 5:118997985-118998007 CTTTACATGCAAGATGTGTAAGG - Intergenic
997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG + Intronic
997800504 5:136856199-136856221 CACCACATGAAGAATGGGGAGGG + Intergenic
1000150212 5:158492865-158492887 CTTCACATGCAGGGTGTTCAGGG + Intergenic
1002139431 5:177130038-177130060 TTTCACAGGCAGTATGTGTAGGG + Intergenic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1006382897 6:33711155-33711177 CTTCAAATGCAGAATCTCTAGGG - Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007256592 6:40534025-40534047 TTTCTCATGTAGAAAGTGGAAGG - Intronic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1017179153 6:151533710-151533732 CTTCAGATGAAGGAGGTGGAAGG - Intronic
1018552379 6:165012486-165012508 ATTTTCATGCAGAATGGGGAAGG - Intergenic
1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG + Intergenic
1021856821 7:24865211-24865233 CTTTACAAGCAAAATATGGAAGG + Intronic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024370375 7:48576398-48576420 CTTCACATGGAGAATCTGGTAGG - Intronic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1027554525 7:79647436-79647458 CTTAAAATTCAGAATCTGGATGG - Intergenic
1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG + Intronic
1028837954 7:95395947-95395969 TTTCCCAAGCAGAATGTTGAGGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031108073 7:117570153-117570175 CTTCACCTTCATAAGGTGGATGG - Intronic
1033063995 7:138135249-138135271 CTTCTAATGCAAAATGTGTAGGG - Intergenic
1034731872 7:153394179-153394201 TTTTACATGCAGGATGTGTAAGG + Intergenic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG + Intronic
1037390949 8:18391253-18391275 CTTCCCTTGCAGACTTTGGAAGG + Exonic
1039458092 8:37721158-37721180 CTACACTTTCAGAATGGGGAGGG - Intergenic
1039680725 8:39732652-39732674 CTTGATATCCAGAATGTAGAAGG + Intergenic
1039848086 8:41340328-41340350 GTTCACATCCAGAAGCTGGAAGG - Intergenic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1045256361 8:100526979-100527001 CTTCACACGTATAATGTGGAAGG + Intronic
1046407125 8:113789134-113789156 CTGGACATGCAGTATGTGCATGG + Intergenic
1047254660 8:123206504-123206526 CTCCACCTGTGGAATGTGGAGGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1048790861 8:138102029-138102051 CTTCAGGTTCAGAATCTGGATGG + Intergenic
1049855072 8:144856629-144856651 CTTCACCTGCAGACAGTGGGTGG - Intergenic
1050847942 9:10247062-10247084 CTTCACATGCATAAAATGTAAGG + Intronic
1051520379 9:17980880-17980902 CTGCCCATGCAGAAGGTGAAGGG + Intergenic
1056268128 9:84920183-84920205 ATTCACATTCATAAGGTGGAGGG + Intronic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1186088628 X:6019734-6019756 CTTCTCATCCAGTATGTGAAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186610147 X:11130977-11130999 CTGCTCATGCAGTCTGTGGAAGG - Intergenic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1192810378 X:74542024-74542046 CTTCAAGTTCAGAATGTGCATGG - Intergenic
1193261526 X:79412188-79412210 ATTCACATGAAGGATGTGGTAGG - Intergenic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1199114949 X:143980781-143980803 CTGCACGTGCAAAATGTGGCAGG + Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1201613260 Y:15866640-15866662 CTCAAAATGCAGTATGTGGATGG + Intergenic