ID: 962932852

View in Genome Browser
Species Human (GRCh38)
Location 3:140053540-140053562
Sequence ATGTGTGTGGAGGACTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962932847_962932852 13 Left 962932847 3:140053504-140053526 CCAGATGCAGCGTGGTGGTGAGT 0: 1
1: 0
2: 1
3: 15
4: 111
Right 962932852 3:140053540-140053562 ATGTGTGTGGAGGACTGCCCAGG 0: 1
1: 0
2: 1
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962932852 Original CRISPR ATGTGTGTGGAGGACTGCCC AGG Intronic
900250015 1:1663861-1663883 CTGTGTGTGGAGGACAGGCCAGG - Exonic
900261048 1:1729771-1729793 CTGTGTGTGGAGGACAGGCCAGG - Intronic
900378593 1:2372761-2372783 CTGAGTGTGGACGACTGCCCAGG - Intronic
900610989 1:3544586-3544608 CGGTGTGTGGAGCACTCCCCAGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901318404 1:8324244-8324266 ATGTTGGGGGAGGACTACCCAGG + Intronic
902397152 1:16138624-16138646 ATGTGTGTGAAGCACTTCCTGGG - Intronic
903056815 1:20641851-20641873 ATGTGGGAGGAGGGCAGCCCAGG - Intronic
903174229 1:21571020-21571042 ATGTGTCTGGAGGACCCACCAGG - Intronic
903350291 1:22712713-22712735 CTGGGTGTGGAGGGCAGCCCTGG + Intronic
904459898 1:30670361-30670383 ATGTTTCTCCAGGACTGCCCTGG + Intergenic
904746786 1:32716381-32716403 AGGTGTGTGGCGGGATGCCCAGG + Intergenic
905939886 1:41854467-41854489 CTGTGTCTGGAGCACTGCTCAGG + Intronic
907636876 1:56144171-56144193 ATTTTTGTGGGGGACTGTCCTGG - Intergenic
907859229 1:58335312-58335334 ATGAGGGTGGAGGAGTGGCCTGG + Intronic
912709220 1:111937796-111937818 ATGTGTGTTCAGGCCTACCCAGG - Intronic
920353911 1:205356428-205356450 CTGTGAGAGGAGGGCTGCCCAGG - Intronic
1062802830 10:392679-392701 ATGTGTGTTGAAGACTCCACTGG - Intronic
1063008033 10:1993533-1993555 ATCTGTGTGGAGGACTGTGTGGG - Intergenic
1064068361 10:12203195-12203217 ATGGCTGTGGAGGTCTGCCATGG + Intronic
1065749434 10:28872173-28872195 TTGTGTGTGGAGAAGTTCCCAGG + Intronic
1069557437 10:69407370-69407392 CTGTGTGTGGAGCAGTTCCCAGG - Intronic
1070865400 10:79705639-79705661 CTGAGTGCGGAGCACTGCCCTGG + Intronic
1072499167 10:95994937-95994959 TTGTGGGTGGAGGATTACCCAGG - Intronic
1072622211 10:97087544-97087566 ATGAGTGAAGAGCACTGCCCTGG + Intronic
1076377843 10:130003413-130003435 AGGTGTCTGGAGGCCAGCCCCGG - Intergenic
1077156297 11:1093216-1093238 AGGTGTGAGGGGGCCTGCCCTGG + Intergenic
1077470160 11:2754213-2754235 ATGTATCTGGAGGAGGGCCCTGG + Intronic
1077487253 11:2844720-2844742 ATGGGTGTGGAGGCCTTCACAGG - Intronic
1079357924 11:19745461-19745483 AGGTGTGTGGAGGGCTACTCTGG - Intronic
1079993011 11:27266393-27266415 ATGTGTGTGGAGCACTGGGCTGG + Intergenic
1082008688 11:47436103-47436125 ATCTGTGTGGAGGGGTGACCTGG - Intergenic
1087704523 11:101474993-101475015 TTTTGTGAGGAGGACTGCCCTGG + Intronic
1089053546 11:115566029-115566051 ATATGAGTGGAGGCTTGCCCAGG + Intergenic
1089084511 11:115805737-115805759 ATGGGTGGGGAGGGATGCCCAGG - Intergenic
1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG + Intergenic
1090401932 11:126454491-126454513 GTGGGTGTGAAGGGCTGCCCTGG + Intronic
1094639407 12:32259329-32259351 TTGTGGGTGGAGGATTACCCAGG - Intronic
1096493833 12:52027670-52027692 ATGTGGGTGGAGTGCAGCCCTGG - Intronic
1101023300 12:100574430-100574452 CTCAGTTTGGAGGACTGCCCGGG + Intronic
1101204655 12:102474516-102474538 ATGTGTGTGTATGACTGGCAGGG - Intronic
1102402912 12:112646455-112646477 ATGTGAGTGGACGTCTGCCAGGG - Intronic
1102567105 12:113803912-113803934 ATGTGTGGGGATGACTCCCATGG + Intergenic
1104823226 12:131690652-131690674 AGTTGTGAGGAGGACTGGCCAGG - Intergenic
1104948931 12:132429972-132429994 AGGTGTGTGCAGGTGTGCCCAGG - Intergenic
1106181258 13:27371658-27371680 TTGGGTGGGGAGGACTGGCCAGG - Intergenic
1106715837 13:32387149-32387171 GTGTGGGTGGAGGATTACCCAGG + Intronic
1107698673 13:43024846-43024868 ATGAGTTTGGAGGACAGCCTGGG + Intronic
1110464958 13:75789973-75789995 ATGTGTGGGGAGGGCTGGCTTGG + Intronic
1112131870 13:96533616-96533638 ATGTGAGTGGAGGACAGCCATGG - Intronic
1113772117 13:112916998-112917020 ATGAGGGAGGATGACTGCCCTGG - Intronic
1117206542 14:53449628-53449650 ATGTGGGTGAGGGACTGCTCCGG + Intergenic
1117725562 14:58669514-58669536 ACGTGTGTGGACGATGGCCCAGG - Intergenic
1119565139 14:75622374-75622396 CTGTGTGGGGACAACTGCCCAGG - Intronic
1119723097 14:76904638-76904660 GTGAGTGTGAAGGTCTGCCCAGG - Intergenic
1120979462 14:90277677-90277699 TTGAGTGTGGAAGGCTGCCCGGG - Exonic
1122956220 14:105072763-105072785 CAGGGTGTGGATGACTGCCCTGG + Intergenic
1125622226 15:41073668-41073690 ATGGAGGTGGAGGACTGCCATGG + Intronic
1127417018 15:58768203-58768225 ATGTGGGTGGAGGATTACCTAGG + Intergenic
1127654640 15:61044863-61044885 AAGTCTGTGAAGCACTGCCCTGG + Intronic
1128869908 15:71146778-71146800 AGATTTTTGGAGGACTGCCCTGG + Intronic
1129606953 15:77029614-77029636 GTGTGTGGGGAGTACCGCCCAGG - Intronic
1130059607 15:80560008-80560030 ATGTGTGGGGAGGGCTCTCCTGG - Intronic
1131035443 15:89218925-89218947 AGGTGGGTGGAGGAGAGCCCTGG + Intronic
1132718359 16:1303528-1303550 ATGTGGGTGGGGCACTGCTCAGG + Intergenic
1132937053 16:2486506-2486528 ATGTGTGTGGTGGTCAGGCCAGG + Intronic
1133728927 16:8561443-8561465 ATGTGTGTGTATGAGTGCACGGG - Intergenic
1134094052 16:11407179-11407201 AGGTGTGTGGAGGTCAGCCCAGG - Exonic
1138630593 16:58291423-58291445 AAGTGTGTTGAGGACTCCCAGGG - Intronic
1140466807 16:75189389-75189411 AAGTGTGTGTAGGTTTGCCCTGG - Intergenic
1141252879 16:82374769-82374791 ATGTTTGTGGAGCACTGCAATGG + Intergenic
1141760642 16:86026501-86026523 GTGTGTGTGCAGGCCTGCCTAGG + Intergenic
1142266534 16:89066551-89066573 ATGTGTGTGGACGAGTCCCATGG - Intergenic
1142419163 16:89959944-89959966 TTGTGTCTGGAGGACTGTTCCGG + Intronic
1142867664 17:2800434-2800456 ATCTGTATGGAGGAGTCCCCGGG - Intronic
1143270866 17:5673498-5673520 ATGTGTGAGGACCACTGCTCTGG - Intergenic
1145809166 17:27754537-27754559 TTTTGTGTGGTGGGCTGCCCTGG + Intergenic
1146833624 17:36091870-36091892 TTGTGTCTGGATAACTGCCCGGG + Intergenic
1146848207 17:36198699-36198721 TTGTGTCTGGATAACTGCCCGGG + Intronic
1149516853 17:57287442-57287464 CTGCGGGTGGAGGACTGCCGGGG + Intronic
1151212316 17:72553851-72553873 ATGTGTGTGCATGTGTGCCCAGG - Intergenic
1157496931 18:48162782-48162804 TTGTGTGCTGAGAACTGCCCTGG - Intronic
1160319577 18:77877587-77877609 ATGTGTGTGGGGAGCTGCCTGGG - Intergenic
1161725898 19:5928615-5928637 ATGTGTGTTGAGGAATGCCCAGG + Intronic
1163752627 19:19086964-19086986 ATGTGTGTGGGGGGGTGCGCTGG + Intronic
1167101026 19:47404407-47404429 ATGAGAGTGGAGGCCTGCACAGG - Intronic
1167780217 19:51594126-51594148 ATGGGAGTGGACGCCTGCCCAGG - Intergenic
1167939056 19:52931630-52931652 TTGTGGGTGGAGGATTACCCGGG + Intronic
926361687 2:12094077-12094099 ATTTGTGTGGAGGTGTGTCCAGG - Intergenic
926636998 2:15191572-15191594 TTTTGTGTGGAGGACAGCACAGG + Intronic
926798849 2:16641120-16641142 CTGTGTGTGCAGAACTGTCCAGG - Intronic
928949032 2:36798369-36798391 ATGTATGTAGAGGAATGGCCAGG + Intronic
935044117 2:99464016-99464038 ATGTGTAGGGAGGACTACACTGG - Intronic
936281464 2:111143792-111143814 ATGTGTGTCGGGGACAGCTCTGG + Intronic
936966144 2:118129380-118129402 GTATGTGTGGAGGAAGGCCCTGG + Intergenic
938060434 2:128250513-128250535 CTGTGAGTGGAGAACAGCCCAGG + Intronic
941332481 2:164195657-164195679 CTGAGTGGGGAGGATTGCCCAGG - Intergenic
942415631 2:175756274-175756296 ATATGTGCTGAGGACTGGCCTGG - Intergenic
945997490 2:216450230-216450252 ATGTTTATGAAGGACTGCCTAGG + Intronic
947752906 2:232541983-232542005 AAGTGTGGGGAGGAGGGCCCGGG + Intronic
948396781 2:237650481-237650503 CACTGTGTGGAGGACAGCCCTGG + Intronic
1173189970 20:40868705-40868727 ATGGGTGTGGAGGCTTGACCAGG + Intergenic
1175692612 20:61076358-61076380 ATGTGTGTGGCTGAATGTCCTGG - Intergenic
1178350093 21:31866739-31866761 ATTTGTGTTGAGCACTCCCCAGG + Intergenic
1179710079 21:43208201-43208223 ATGTGTGTGGGGGGCTGCCTGGG + Intergenic
1180237772 21:46474534-46474556 ATGTGTGTGGAGGATTTTCTGGG + Intronic
1183014316 22:34973341-34973363 CTGTGTGTGGAGGAGGCCCCAGG + Intergenic
1184133377 22:42531148-42531170 GTGTGAGTGGAGGACTGTCCAGG + Intergenic
1184350746 22:43942201-43942223 AGCTGTGTGGTGGACAGCCCAGG - Intronic
1184864898 22:47196945-47196967 ATGTGTGTGGATGCCTTCTCTGG + Intergenic
1185008347 22:48299094-48299116 ATGTGTCTGGAAAAATGCCCAGG + Intergenic
1185047583 22:48536832-48536854 CTGTGTGTGGAGGAGTGGCTGGG + Intronic
1185253953 22:49821730-49821752 ATGTGAGGGGAGGACAGCACAGG - Intronic
949275733 3:2278019-2278041 AAGTGTGTGCAGGACTGTCTAGG + Intronic
954078327 3:48197233-48197255 ATGTGTGGGGATGTCTTCCCAGG - Intergenic
955056474 3:55460003-55460025 ATGTTTGTGGAGGGCAGCCCTGG + Intergenic
961033811 3:123628621-123628643 ATGTGTAGGGAGAGCTGCCCAGG - Intronic
962932852 3:140053540-140053562 ATGTGTGTGGAGGACTGCCCAGG + Intronic
963566227 3:146934518-146934540 CTGTGTGAGGAGGACTCCACCGG - Intergenic
967864760 3:194181129-194181151 CTGTGTGTGGATGACAGGCCTGG - Intergenic
968497136 4:924957-924979 ATGGGGGTGGAGTTCTGCCCGGG + Intronic
968816315 4:2823594-2823616 ATGTGGGTGGGGGAGTGCACTGG + Intronic
969442397 4:7225160-7225182 ATGTGTGTGCAGCACAGCACGGG - Intronic
969539093 4:7774711-7774733 AAGGGTGTGGGTGACTGCCCAGG - Intronic
973530234 4:51830439-51830461 AAGTGTCTGGAGCACTGGCCTGG - Intergenic
973826075 4:54708764-54708786 GTGTGGGTCGTGGACTGCCCAGG + Intronic
974616070 4:64284137-64284159 ATGTTTTTGGAGCACTGTCCTGG + Intronic
976133007 4:81905075-81905097 ATGTGTTTGCAAGACAGCCCAGG + Intronic
976615707 4:87073993-87074015 ATGTGTGTGTAGGACTGGATGGG + Intronic
985684634 5:1275568-1275590 AGGGGTGTGGAGGCCTCCCCTGG - Intronic
986597286 5:9437000-9437022 AATTGTGTGGAGGCCTGACCAGG + Intronic
987644215 5:20648228-20648250 ACCTGTGTGGAGGACAGTCCAGG - Intergenic
992966890 5:82011846-82011868 ATGTGAGTGGAAGGCTGCCAGGG + Intronic
993002353 5:82394179-82394201 ATGTGTGAGGAGGAGGGCCTAGG + Intergenic
993730349 5:91414834-91414856 ATGTGGGTGAAGAATTGCCCTGG - Intergenic
994777188 5:104049676-104049698 ATAGGTGTCCAGGACTGCCCGGG + Intergenic
994838233 5:104885396-104885418 ATGTGTGTGTGAGACTGTCCTGG + Intergenic
997889181 5:137659961-137659983 GTGTTGGTGGAGGTCTGCCCAGG + Intronic
998142461 5:139707884-139707906 CTGTGTGTTGAGGACTGTTCTGG + Intergenic
998911322 5:146963463-146963485 GTGTGAGTGGAGGACTAACCTGG - Intronic
1000012841 5:157248954-157248976 ACGTGTGTGGAGGCCAGCCGGGG - Exonic
1001559031 5:172657321-172657343 CTGTGGGTGGAGGATTACCCAGG + Intronic
1004140193 6:13011028-13011050 ATGTGTGTGAAGAAGGGCCCAGG - Intronic
1004326405 6:14677530-14677552 ATCTGTGGGGAGGGCTGACCAGG - Intergenic
1006368778 6:33632082-33632104 CTGTGGGTGGAGGATTACCCAGG - Intronic
1013967467 6:115972116-115972138 ATGTGGTGGGAGAACTGCCCAGG - Intronic
1017643110 6:156513407-156513429 CTGTGTTTGGAGGACTCCACTGG - Intergenic
1023059909 7:36316897-36316919 ACGTGTGAGGACCACTGCCCCGG - Intergenic
1023862106 7:44222889-44222911 ATGTGTGTGGGGCACTGCCTGGG + Intronic
1024502783 7:50130708-50130730 AGGTGTGGGGAGGCCTCCCCAGG + Intronic
1024564595 7:50671116-50671138 CTGTGTGTCCAGGAGTGCCCTGG - Intronic
1024658384 7:51471497-51471519 ATGTTTGAGGAGAACCGCCCAGG + Intergenic
1030225728 7:107148135-107148157 CTGTGGGTGAAGGACTGTCCTGG - Intronic
1032013644 7:128361935-128361957 ATGTGTGTGCTGGGCCGCCCTGG - Intergenic
1032154147 7:129454484-129454506 CTGTGGGTGGAGAACAGCCCGGG + Exonic
1032861644 7:135885400-135885422 ATGTGTGTGATGTTCTGCCCAGG + Intergenic
1035228133 7:157444757-157444779 ATGTGTGCAGAGGATGGCCCAGG + Intergenic
1036532621 8:9608619-9608641 ATGTCTGTGAAGGAGTCCCCAGG - Intronic
1038576610 8:28709800-28709822 ATGTGAGAGGAGGAGGGCCCTGG + Intronic
1038646286 8:29365203-29365225 CAGTGTGTGGAGGACGTCCCCGG + Intergenic
1038738888 8:30199166-30199188 TTCAGTGTGGAGGAATGCCCAGG + Intergenic
1039196884 8:35042358-35042380 ATTTGTGTGGAGGACAGGACAGG - Intergenic
1040046284 8:42967256-42967278 GTGTGTGTGGAGGGCAGCCGGGG - Intronic
1040475475 8:47773236-47773258 TTGGGTGTGGAGGACTGGCGGGG + Exonic
1041949034 8:63479511-63479533 ATGGATGGGGAGGACTGCGCAGG + Intergenic
1044545444 8:93454216-93454238 ATGTGTTTGAAGGATTCCCCAGG - Intergenic
1045048692 8:98303127-98303149 CTGTCTGTGGAGGACTGGCCTGG - Intergenic
1045896675 8:107226733-107226755 ATGTGTGTGGAAGCCTGCTTGGG - Intergenic
1045951057 8:107852175-107852197 ATGTGTGAGGAGGGCATCCCGGG + Intergenic
1045952644 8:107868546-107868568 ATGTGTTTGGAGGAATGTACAGG - Intergenic
1048349935 8:133608079-133608101 GTGGGTGTGGTGGGCTGCCCAGG + Intergenic
1048894549 8:138978785-138978807 ATTTTTGTGCATGACTGCCCTGG + Intergenic
1051116280 9:13697935-13697957 ATGTGTTTGCAGGACAACCCCGG - Intergenic
1051502299 9:17791130-17791152 CTGTGTGTTGAGGGCAGCCCTGG + Intronic
1053101591 9:35376134-35376156 ATGAGTGTGAAGGCCTGCTCTGG + Exonic
1053391515 9:37739752-37739774 TTGTGTGGGCAGCACTGCCCAGG - Intronic
1058785530 9:108382956-108382978 ATGTGTTTTGAGGACTACTCTGG + Intergenic
1060419935 9:123461174-123461196 ATGTGTCAGGAGGACAGTCCAGG - Intronic
1060620131 9:125057694-125057716 ATGAGGGTGGAGGACTGGCAGGG + Intronic
1060788904 9:126472246-126472268 ATGGCTCTGGAGGACTGCCTTGG + Intronic
1062303742 9:135890202-135890224 ATGTGTGTGGAGCATTCCACAGG - Intronic
1062475400 9:136724239-136724261 CTGTGTTTGGGGAACTGCCCTGG - Intergenic
1186545494 X:10444931-10444953 AAGTGTGTGAAGCACTGCCCTGG - Intergenic
1190511534 X:51178242-51178264 ATGTGGGTGAAGGATTACCCAGG - Intergenic
1190984015 X:55484403-55484425 AGGTGTGTGGAGGGAGGCCCAGG - Intergenic
1195514186 X:105753695-105753717 ATGTACATGAAGGACTGCCCTGG - Intronic
1200118928 X:153781395-153781417 ATGTGGGCCCAGGACTGCCCTGG - Intronic