ID: 962932852

View in Genome Browser
Species Human (GRCh38)
Location 3:140053540-140053562
Sequence ATGTGTGTGGAGGACTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962932847_962932852 13 Left 962932847 3:140053504-140053526 CCAGATGCAGCGTGGTGGTGAGT 0: 1
1: 0
2: 1
3: 15
4: 111
Right 962932852 3:140053540-140053562 ATGTGTGTGGAGGACTGCCCAGG 0: 1
1: 0
2: 1
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962932852 Original CRISPR ATGTGTGTGGAGGACTGCCC AGG Intronic